ID: 1124037960

View in Genome Browser
Species Human (GRCh38)
Location 15:26073799-26073821
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124037960_1124037967 11 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037967 15:26073833-26073855 CAGAAGGCTGACGACTGTGTAGG No data
1124037960_1124037965 -5 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037965 15:26073817-26073839 GAATGTTGAAGACATCCAGAAGG No data
1124037960_1124037968 14 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037960_1124037969 15 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037969 15:26073837-26073859 AGGCTGACGACTGTGTAGGTGGG No data
1124037960_1124037970 24 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037970 15:26073846-26073868 ACTGTGTAGGTGGGATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124037960 Original CRISPR CATTCAGGGAGAATTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr