ID: 1124037963

View in Genome Browser
Species Human (GRCh38)
Location 15:26073813-26073835
Sequence CTGGATGTCTTCAACATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124037963_1124037968 0 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037963_1124037969 1 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037969 15:26073837-26073859 AGGCTGACGACTGTGTAGGTGGG No data
1124037963_1124037970 10 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037970 15:26073846-26073868 ACTGTGTAGGTGGGATGTTTTGG No data
1124037963_1124037971 24 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037971 15:26073860-26073882 ATGTTTTGGAAGCAGAACTGAGG No data
1124037963_1124037967 -3 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037967 15:26073833-26073855 CAGAAGGCTGACGACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124037963 Original CRISPR CTGGATGTCTTCAACATTCA GGG (reversed) Intergenic
No off target data available for this crispr