ID: 1124037968

View in Genome Browser
Species Human (GRCh38)
Location 15:26073836-26073858
Sequence AAGGCTGACGACTGTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124037964_1124037968 -1 Left 1124037964 15:26073814-26073836 CCTGAATGTTGAAGACATCCAGA No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037957_1124037968 20 Left 1124037957 15:26073793-26073815 CCCCTTCCAACCCAAATTCTCCC No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037961_1124037968 10 Left 1124037961 15:26073803-26073825 CCCAAATTCTCCCTGAATGTTGA No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037958_1124037968 19 Left 1124037958 15:26073794-26073816 CCCTTCCAACCCAAATTCTCCCT No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037963_1124037968 0 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037962_1124037968 9 Left 1124037962 15:26073804-26073826 CCAAATTCTCCCTGAATGTTGAA No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037959_1124037968 18 Left 1124037959 15:26073795-26073817 CCTTCCAACCCAAATTCTCCCTG No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037956_1124037968 21 Left 1124037956 15:26073792-26073814 CCCCCTTCCAACCCAAATTCTCC No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037960_1124037968 14 Left 1124037960 15:26073799-26073821 CCAACCCAAATTCTCCCTGAATG No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data
1124037955_1124037968 29 Left 1124037955 15:26073784-26073806 CCACATGACCCCCTTCCAACCCA No data
Right 1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124037968 Original CRISPR AAGGCTGACGACTGTGTAGG TGG Intergenic
No off target data available for this crispr