ID: 1124037971

View in Genome Browser
Species Human (GRCh38)
Location 15:26073860-26073882
Sequence ATGTTTTGGAAGCAGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124037963_1124037971 24 Left 1124037963 15:26073813-26073835 CCCTGAATGTTGAAGACATCCAG No data
Right 1124037971 15:26073860-26073882 ATGTTTTGGAAGCAGAACTGAGG No data
1124037966_1124037971 5 Left 1124037966 15:26073832-26073854 CCAGAAGGCTGACGACTGTGTAG No data
Right 1124037971 15:26073860-26073882 ATGTTTTGGAAGCAGAACTGAGG No data
1124037964_1124037971 23 Left 1124037964 15:26073814-26073836 CCTGAATGTTGAAGACATCCAGA No data
Right 1124037971 15:26073860-26073882 ATGTTTTGGAAGCAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124037971 Original CRISPR ATGTTTTGGAAGCAGAACTG AGG Intergenic
No off target data available for this crispr