ID: 1124038093

View in Genome Browser
Species Human (GRCh38)
Location 15:26075079-26075101
Sequence CTCTTAAGGTTCCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124038093_1124038098 16 Left 1124038093 15:26075079-26075101 CCTCCCTCAGGGAACCTTAAGAG No data
Right 1124038098 15:26075118-26075140 ATAAAGAAAGCTTCAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124038093 Original CRISPR CTCTTAAGGTTCCCTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr