ID: 1124038448

View in Genome Browser
Species Human (GRCh38)
Location 15:26078494-26078516
Sequence TGTTGTACACCCATGGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124038446_1124038448 -1 Left 1124038446 15:26078472-26078494 CCACTTTCATTGGGGTTTGTAAT No data
Right 1124038448 15:26078494-26078516 TGTTGTACACCCATGGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124038448 Original CRISPR TGTTGTACACCCATGGTGCG AGG Intergenic
No off target data available for this crispr