ID: 1124038909

View in Genome Browser
Species Human (GRCh38)
Location 15:26082365-26082387
Sequence GTCGGAGGCGTGGCAGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124038909_1124038916 10 Left 1124038909 15:26082365-26082387 CCGCCTTCTGCCACGCCTCCGAC No data
Right 1124038916 15:26082398-26082420 TGTCTGCGCCTGCGCCTGCGCGG No data
1124038909_1124038917 11 Left 1124038909 15:26082365-26082387 CCGCCTTCTGCCACGCCTCCGAC No data
Right 1124038917 15:26082399-26082421 GTCTGCGCCTGCGCCTGCGCGGG No data
1124038909_1124038919 18 Left 1124038909 15:26082365-26082387 CCGCCTTCTGCCACGCCTCCGAC No data
Right 1124038919 15:26082406-26082428 CCTGCGCCTGCGCGGGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124038909 Original CRISPR GTCGGAGGCGTGGCAGAAGG CGG (reversed) Intergenic