ID: 1124040684

View in Genome Browser
Species Human (GRCh38)
Location 15:26100106-26100128
Sequence CTGGATTTATGTGTTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124040683_1124040684 -10 Left 1124040683 15:26100093-26100115 CCTCATGATTAGACTGGATTTAT No data
Right 1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG No data
1124040681_1124040684 17 Left 1124040681 15:26100066-26100088 CCTCAATTGGTATTTGACTGATG No data
Right 1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG No data
1124040680_1124040684 18 Left 1124040680 15:26100065-26100087 CCCTCAATTGGTATTTGACTGAT No data
Right 1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG No data
1124040679_1124040684 19 Left 1124040679 15:26100064-26100086 CCCCTCAATTGGTATTTGACTGA No data
Right 1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124040684 Original CRISPR CTGGATTTATGTGTTTTTAA TGG Intergenic
No off target data available for this crispr