ID: 1124042534

View in Genome Browser
Species Human (GRCh38)
Location 15:26118541-26118563
Sequence TTCCCACATCACCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124042534_1124042550 28 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042550 15:26118592-26118614 AGTCATGGCTGGACGTGGTCGGG No data
1124042534_1124042546 17 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042546 15:26118581-26118603 TGTGAGAGTCCAGTCATGGCTGG No data
1124042534_1124042552 30 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042552 15:26118594-26118616 TCATGGCTGGACGTGGTCGGGGG No data
1124042534_1124042549 27 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042549 15:26118591-26118613 CAGTCATGGCTGGACGTGGTCGG No data
1124042534_1124042547 23 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042547 15:26118587-26118609 AGTCCAGTCATGGCTGGACGTGG No data
1124042534_1124042551 29 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042551 15:26118593-26118615 GTCATGGCTGGACGTGGTCGGGG No data
1124042534_1124042545 13 Left 1124042534 15:26118541-26118563 CCAGCCCTGGGGTGATGTGGGAA No data
Right 1124042545 15:26118577-26118599 CCAGTGTGAGAGTCCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124042534 Original CRISPR TTCCCACATCACCCCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr