ID: 1124043497

View in Genome Browser
Species Human (GRCh38)
Location 15:26126221-26126243
Sequence GGGGCTGTTTCCCCAGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124043488_1124043497 -1 Left 1124043488 15:26126199-26126221 CCGAAGGCAGCAGCTCCCCCACG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 263
1124043486_1124043497 8 Left 1124043486 15:26126190-26126212 CCGTTCTTCCCGAAGGCAGCAGC 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 263
1124043484_1124043497 26 Left 1124043484 15:26126172-26126194 CCTGCTGCACAGCTAACACCGTT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 263
1124043487_1124043497 0 Left 1124043487 15:26126198-26126220 CCCGAAGGCAGCAGCTCCCCCAC 0: 1
1: 0
2: 1
3: 45
4: 301
Right 1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124043497 Original CRISPR GGGGCTGTTTCCCCAGTTCT GGG Intergenic
901850916 1:12014807-12014829 TGGGCTGTCACCCCAGTGCTTGG - Intergenic
901917633 1:12512159-12512181 GGGGGTGCTTCCCCAGGCCTGGG - Intergenic
902134326 1:14291848-14291870 GGGGCTTTTCCCCCTGTGCTTGG + Intergenic
903237783 1:21961666-21961688 GGGGCTGTCTCCCCAGAGCCTGG + Intergenic
905164700 1:36072937-36072959 GGGGCTGTTTATCCACTTTTGGG - Intergenic
905368281 1:37467834-37467856 GGGGTTGGGTCCCCAGTTTTGGG - Intergenic
908523306 1:64965768-64965790 GGGGGCGTTTCCCGAGTTCGCGG + Intronic
908817421 1:68048648-68048670 GGGTCCTTTTCCCCAGTACTGGG - Intronic
909297723 1:73971711-73971733 TGGTCTGTGTCCCCAGTTCCTGG - Intergenic
909781132 1:79549059-79549081 GTGACTATTTCCCCAGTTCCAGG + Intergenic
912645747 1:111390184-111390206 GTGATTGTTTCCCCAATTCTGGG - Intergenic
913504895 1:119507837-119507859 GTGGCTGCTTCTCAAGTTCTGGG - Intronic
914902847 1:151721179-151721201 GGTTCTCTTTCCCCAGTACTAGG + Intronic
915080067 1:153345877-153345899 GAGGCTGTTTCCCCTCTTCCTGG + Intronic
915301405 1:154953609-154953631 GGGGGTGTTTCTGCAGTGCTGGG - Intronic
917857034 1:179109229-179109251 GGGGCTGATTCTCCATTTCTCGG + Exonic
918232789 1:182551018-182551040 GGCCCTGTTTCCCCTGTGCTCGG + Intronic
918487250 1:185043023-185043045 GGGGCTGTACAACCAGTTCTGGG + Intergenic
918851228 1:189693140-189693162 GTGGCAATTTCCCCAGTTTTAGG + Intergenic
921724232 1:218506727-218506749 GGGGCTTTTCCCCCTTTTCTTGG + Intergenic
923498364 1:234544175-234544197 GGGGCTGTTTCCACACTTAATGG + Intergenic
1064102594 10:12476423-12476445 GGGGCTTCCTCCCCTGTTCTGGG - Intronic
1066518325 10:36188391-36188413 GGGGCTGTTCCTCCAGCTGTTGG - Intergenic
1068312284 10:55293375-55293397 GGGACATTTTCCCCATTTCTTGG + Intronic
1068974123 10:62989823-62989845 GGTGCTGTTTCCCCATCTCATGG - Intergenic
1069898488 10:71693927-71693949 GGAGCTGGTTCCCCAGGGCTGGG - Intronic
1071925160 10:90398263-90398285 GTGGCTTTATCCCCAGTGCTTGG - Intergenic
1072545404 10:96433075-96433097 GGGGCTATTTCATCAGTTCAGGG + Intronic
1073354063 10:102839944-102839966 GGGGAAGATTCCCAAGTTCTGGG + Intergenic
1075809848 10:125217217-125217239 GGGGTTTTTTCCCCACCTCTGGG - Intergenic
1075832563 10:125423843-125423865 GGGGAAGTTTCCTCCGTTCTGGG - Intergenic
1076482495 10:130793786-130793808 GGGGATGTTTCCACAGTACCAGG - Intergenic
1076586186 10:131549244-131549266 GGGGCTTTGTGGCCAGTTCTTGG - Intergenic
1077353458 11:2103701-2103723 AGGCCTGTGTCCCCAGTTCCCGG - Intergenic
1078675143 11:13404649-13404671 GTTGCTATTTCCTCAGTTCTAGG - Intronic
1079466428 11:20735429-20735451 GGGGCTTTTTCCCCTCTGCTTGG - Intronic
1079880504 11:25921457-25921479 GGGGCTGTATCCCCTTTTTTTGG - Intergenic
1080441067 11:32295093-32295115 GGGGCTTTTTCCCCTTTGCTTGG - Intergenic
1081537042 11:44003945-44003967 GGAGCTGTTCCCCCAGGCCTTGG + Intergenic
1082998030 11:59268225-59268247 GGGGCTGATTCCTTAGGTCTTGG + Intergenic
1083195107 11:61081432-61081454 GGAGCTCTGTCCCCAGCTCTGGG + Intergenic
1083387836 11:62325086-62325108 GGCGCTGTTTCCCCAGGGATCGG - Intergenic
1083774522 11:64887980-64888002 GGGGCTGCTCCCCCAGGCCTTGG + Intronic
1084391602 11:68880869-68880891 GGGTCTTTGTCCCCTGTTCTGGG - Intergenic
1085625130 11:78065971-78065993 GGGGCTGTGTCAACAGCTCTGGG + Intronic
1085710251 11:78823119-78823141 TTGGCTGTCTCCCCAGTACTTGG - Intronic
1085955073 11:81382433-81382455 GGAGCTTTGTCCCCAGGTCTTGG + Intergenic
1086530377 11:87777944-87777966 AAGGCTGTTTCCCCCTTTCTAGG + Intergenic
1087346312 11:96975659-96975681 TGGGCAGTTTCCCCACTTCCTGG - Intergenic
1087495871 11:98890404-98890426 GGGGATGTTTCCCAAGGCCTTGG + Intergenic
1088530222 11:110800074-110800096 GAGCCTGTGTCCCCATTTCTGGG - Intergenic
1088658648 11:112025648-112025670 GCGGCTGGACCCCCAGTTCTGGG + Exonic
1089219315 11:116857861-116857883 AGGGATGTATCCCCAATTCTTGG + Exonic
1091551056 12:1535091-1535113 GGGGCTGGTGCCTGAGTTCTAGG + Intronic
1092884988 12:12917059-12917081 GGGGTTGATTTCCCAGTTCCTGG - Exonic
1092995637 12:13947912-13947934 GGGGCTGCTTCTCTGGTTCTGGG - Intronic
1095544269 12:43346112-43346134 GGGGCTTTTTCCCCTTTGCTTGG - Intergenic
1095689143 12:45068218-45068240 GGGGCTTTTCCCCCTGTGCTCGG - Intergenic
1096462452 12:51829463-51829485 GAACCTCTTTCCCCAGTTCTGGG + Intergenic
1097378100 12:58861816-58861838 GGGGCTTTTTCCCCTTTGCTTGG - Intergenic
1098666986 12:73176700-73176722 GGGACTCTTTCCACTGTTCTAGG - Intergenic
1099166703 12:79315623-79315645 GGGGCTGTTTCAAAAGTTTTGGG + Intronic
1101862165 12:108491568-108491590 GGGACTCTTTCTCCATTTCTTGG - Intergenic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1103592865 12:122004551-122004573 GGGGCCGGTTCCCCAGCTCTGGG + Intergenic
1103731361 12:123029917-123029939 GGGTCTGTTTTCCCAGTTTCTGG - Intronic
1104769824 12:131354436-131354458 GGGGCTGTGTCCCCAGCGCCTGG - Intergenic
1107947610 13:45433522-45433544 AGGGCTGTGTTCTCAGTTCTTGG + Intergenic
1109838117 13:67885949-67885971 GGGGAGGTATCCTCAGTTCTGGG - Intergenic
1110678727 13:78282615-78282637 ACGGCTGTATCCCCAGTTCCTGG - Intergenic
1113533546 13:111046419-111046441 GTGGCTCCTTCCCCAGGTCTGGG + Intergenic
1113900105 13:113792019-113792041 GGGGCCGCGTCCCCAGCTCTGGG - Intronic
1115736268 14:36333878-36333900 GGGGCGGTTTCCCCATTATTTGG + Intergenic
1116393538 14:44421884-44421906 GGGGCTTTTTCCCCTTTGCTTGG - Intergenic
1117960075 14:61153982-61154004 GGGGCTGTTTGTCCAGCTCTAGG + Intergenic
1119732888 14:76962237-76962259 GGGGCTATTGCCCAAGTCCTGGG + Intergenic
1120529011 14:85609716-85609738 GGGGCTGCTCCCCCAGCTCATGG - Intronic
1121336983 14:93083595-93083617 GGGGCTTTTTCCCCAGTGCCTGG - Intronic
1121867401 14:97375747-97375769 CGGGCTGTTTCTTCACTTCTTGG - Intergenic
1122072855 14:99215957-99215979 GGGGCTTTTTCCTCTGTTCCCGG - Intronic
1122283702 14:100638787-100638809 GGGGCTGTGTGCCCAGGACTGGG - Intergenic
1122466282 14:101935807-101935829 GGGGCTGGCTCGCCAGTTATGGG - Intergenic
1123933098 15:25181323-25181345 GGTGCTGTTTCCCTAGGTTTGGG + Intergenic
1123936905 15:25198448-25198470 GGGGCTGTTTCCCTGGGTTTGGG + Intergenic
1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG + Intergenic
1124551702 15:30686991-30687013 GGGGCTGTTTAACAAGTGCTGGG + Intronic
1126087706 15:45024771-45024793 GGGGCTGTGTCCTCCTTTCTGGG - Intronic
1127994623 15:64145997-64146019 CTGCCTGTTGCCCCAGTTCTTGG + Intronic
1129195121 15:73959870-73959892 GGCACTGTTTCCCAAGTTTTCGG - Intergenic
1130932068 15:88436756-88436778 GGGGCAGTTTCCCCAGGTCTTGG - Intergenic
1131374170 15:91909909-91909931 GCAGCTGTTTCCACAGTGCTGGG - Intronic
1131514542 15:93068297-93068319 GGGGTTCTCTGCCCAGTTCTAGG + Intronic
1132284560 15:100652975-100652997 AGCCCTGTTTCCCCAGTGCTTGG + Intergenic
1134011937 16:10860276-10860298 GGCTCTATTTCCCCAGTTCACGG - Intergenic
1136116814 16:28099762-28099784 GGGACTGGTGCCCCAGTTCCTGG + Intronic
1142130012 16:88428102-88428124 GGGGCTGGTGCCCCTGCTCTGGG - Exonic
1142357090 16:89606302-89606324 AGGGCTGTTCCCCCAGCCCTGGG + Intergenic
1143779575 17:9222178-9222200 GGGGCTGGCCCCCCAATTCTGGG + Intronic
1144059325 17:11568288-11568310 GAGGCTGCTTCCCTATTTCTGGG - Intergenic
1144659966 17:17061613-17061635 GGGGCTGATGCCCCAACTCTGGG - Intronic
1144726874 17:17506596-17506618 GGGGCTGCGTTCCCAGCTCTGGG - Intronic
1145767851 17:27471615-27471637 GGGGCTGTTTTTTCAGTGCTGGG + Intronic
1146718144 17:35103471-35103493 GCGGTGGTTTCCCCACTTCTGGG - Exonic
1147140648 17:38458841-38458863 GGGGCTGCCTCCCCATCTCTGGG + Intronic
1148048916 17:44759706-44759728 GGCCTTGTTTCCCCAGGTCTTGG + Exonic
1148744577 17:49911263-49911285 GTGGCTGTTTGCCCAGTTGCTGG + Intergenic
1148865331 17:50625404-50625426 GGGGCTGTGTCGCCAGTGCCTGG - Intronic
1149610096 17:57953712-57953734 AGGGCTGTATCCCCAGCTCCTGG - Intronic
1150293771 17:63997315-63997337 GGGGCTGTGACCCCAGTGCCTGG + Intergenic
1151145280 17:72034709-72034731 GGCCCTGTTTCCCTAGTCCTAGG + Intergenic
1151878705 17:76881754-76881776 GGGGCTTCTTTCCCAGTGCTGGG + Intronic
1152488081 17:80608704-80608726 GGGGCACTTTCCCCCCTTCTTGG + Intronic
1152645603 17:81467237-81467259 GCGGCTGTTGCCCCGGTTCCTGG + Intergenic
1152904252 17:82961662-82961684 GGGGCTGCCTCCCCACTGCTGGG - Intronic
1152962586 18:88705-88727 GTGGGTGTTTCTCCAGTGCTGGG - Intergenic
1153352693 18:4098451-4098473 GAGGCTGTTTCACCAGTCCAGGG + Intronic
1153929717 18:9867378-9867400 GGGGCTGACTCCCCAGTCCCTGG - Intergenic
1155053427 18:22166662-22166684 GGGGCCTTCTCCCCAGCTCTTGG + Intergenic
1155538775 18:26844927-26844949 GGGGCTGTTCCCTCATTCCTTGG + Intergenic
1157739951 18:50083530-50083552 GGGTCTTTGTCCTCAGTTCTTGG - Intronic
1160609587 18:80075016-80075038 TGTGCTGTGTCCTCAGTTCTGGG + Intronic
1165854411 19:38871019-38871041 GGAGCTGCTGCCCCTGTTCTAGG - Intronic
1165860540 19:38907092-38907114 GGGGCTGGTTCCTGAATTCTTGG - Intronic
1166317712 19:41998305-41998327 GAGACGGTATCCCCAGTTCTGGG + Exonic
1166924860 19:46260553-46260575 GGTGCAGTTTCCACACTTCTGGG + Intergenic
1166968679 19:46547363-46547385 GGGGCTCTTTCCCCTTTACTGGG + Intronic
1167591998 19:50409188-50409210 GGGGCTGCTGCCCCAGATCCTGG + Exonic
1167890592 19:52536410-52536432 AGCGCTGTGTCCCCAGTCCTGGG + Intronic
1168617403 19:57849882-57849904 GCGGGTGTTTCCCCAGTTTGTGG + Exonic
1168625761 19:57916547-57916569 GCGGGTGTTTCCCCAGTTTGTGG - Exonic
1168640628 19:58029182-58029204 GGGGCTGTTACCCCTGGCCTGGG - Intergenic
925702985 2:6657598-6657620 GGGGCTCAGTCCCCATTTCTAGG + Intergenic
926735643 2:16071331-16071353 GGCCCTCTTTCCCCAGTCCTTGG + Intergenic
926869096 2:17392384-17392406 GGGGCTTTTTCCCCTTTGCTTGG + Intergenic
926887670 2:17612882-17612904 AGGGCTCAGTCCCCAGTTCTAGG + Intronic
928614122 2:33019459-33019481 GGGCCTGTAATCCCAGTTCTCGG - Intronic
929444710 2:41992740-41992762 GGGGCTGTTTCCCCACCACCAGG + Intergenic
929616424 2:43312828-43312850 GGTGCTGTTTTCTCAGCTCTGGG - Intronic
930799934 2:55433517-55433539 TGGGCTTTTTCCCCATTTCCTGG + Intergenic
932928264 2:76002538-76002560 GGTTCTGTTTCGCCAGGTCTAGG + Intergenic
933073703 2:77895162-77895184 GGGGCTTTTCCCCCTTTTCTCGG - Intergenic
935708870 2:105880008-105880030 TGGGGTGTGTCCCCAGCTCTGGG + Intronic
937112222 2:119375553-119375575 GGGGAAGATTCCCAAGTTCTGGG + Intergenic
937266402 2:120617351-120617373 GGGGCTGCTTCCCCGGCTCCAGG + Intergenic
941115872 2:161471777-161471799 GGTCCTGTTTCCCCATATCTTGG + Intronic
941445370 2:165592662-165592684 GGGGCTTTTTCCCTTTTTCTTGG + Intronic
942595452 2:177587780-177587802 CGGCCTGTTTCCCCAGTGCCTGG - Intergenic
945019265 2:205554963-205554985 GGGGATGATTCCCCATTCCTTGG - Intronic
945176523 2:207048947-207048969 GGGGCAGCTTCCCCAGTTTGTGG + Intergenic
945456210 2:210055160-210055182 GGGGCTTTTTCCCCTTTGCTTGG + Intronic
946084392 2:217156434-217156456 GGGGCTGTCTCCACAGTCCATGG + Intergenic
946410341 2:219512400-219512422 GGGGCAGTTTCCCGCTTTCTTGG + Intergenic
946472391 2:219974373-219974395 GGGGCTTTTTCCCCTTTGCTTGG - Intergenic
946642700 2:221801531-221801553 GAAGCTGTTTGCCCAGTTCCTGG - Intergenic
947739716 2:232479584-232479606 AGGGCTTCTTGCCCAGTTCTGGG - Intergenic
948281871 2:236753169-236753191 GGGGCTCTTTACCCTGTTCCTGG + Intergenic
948718881 2:239883633-239883655 GGGGCTGTGTGTCCAGCTCTGGG - Intergenic
1170122518 20:12926174-12926196 AGGGCTGTGTCCTGAGTTCTGGG - Intergenic
1171321628 20:24249144-24249166 GGGGCTGCCTCCTCAGTGCTGGG - Intergenic
1174188086 20:48721202-48721224 GGGCCTGTTTCCTCAGTGCCTGG - Intronic
1174843722 20:53922998-53923020 AGGGCTGTTTCAGCAGTTATGGG + Intergenic
1176084776 20:63290935-63290957 GGGGCCATGTCCCCAATTCTGGG + Intergenic
1176200930 20:63860263-63860285 GGGGCTATTACCCCCATTCTAGG - Intergenic
1176921007 21:14687317-14687339 GGTCCTCTTTCCTCAGTTCTGGG - Intergenic
1177858027 21:26421060-26421082 GGGGCTTTTTCCCTTTTTCTTGG - Intergenic
1179493415 21:41756263-41756285 GGGGCTGTTCCCCCAAATCTTGG - Intronic
1180793752 22:18591904-18591926 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181001998 22:19992158-19992180 GGGCCTGTTTTCCCAGCTGTCGG - Intronic
1181023462 22:20115108-20115130 GGGACTGCTTGCCCAGTTGTGGG - Intronic
1181227988 22:21403416-21403438 GAGGCTGTTGCCCCAGCTCAGGG + Intergenic
1181250665 22:21531423-21531445 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181722502 22:24786589-24786611 GGGCCTGTTTCCCCAGGCTTTGG + Intergenic
1184242905 22:43220830-43220852 GAGGCTGTGCCCCCAGCTCTGGG + Intronic
1184511071 22:44933512-44933534 TGGTCTGTTTCCCCAGATCGCGG - Intronic
1184884057 22:47331439-47331461 GGGTCTCTGTCCCCAGTCCTGGG - Intergenic
949625662 3:5863929-5863951 GGGGCTCTTTTCCCATCTCTGGG - Intergenic
949682259 3:6527774-6527796 GGGGCTGTGTCCTCAGTTTAGGG - Intergenic
949924351 3:9029116-9029138 CAGGCTGTTTGCTCAGTTCTGGG - Intronic
950450706 3:13063573-13063595 GGGGCTGGGGCCCCGGTTCTGGG + Intronic
950502740 3:13374766-13374788 GGGGTTGTTTCCTCTGGTCTGGG - Intronic
951152188 3:19303880-19303902 GGGTCTATTTCCCCAGCTCTTGG - Intronic
952762588 3:36927826-36927848 AGGGCTGTTTCCCCAAATTTTGG + Intronic
953157506 3:40387886-40387908 GGGGCTGTCTCTGAAGTTCTGGG + Intronic
953390660 3:42531889-42531911 GGGCCTGTTTCCCCATCTCTAGG - Intronic
953822581 3:46221432-46221454 GGGCCTGATTCCCTAGTTGTAGG + Intronic
954154984 3:48680453-48680475 GGGGGTGTTTATCCAGGTCTGGG - Intronic
954173117 3:48821321-48821343 GGAGGTATTTCCCTAGTTCTGGG - Intronic
954437190 3:50502654-50502676 GAGGCAGTGTCCCCTGTTCTTGG - Intronic
955781091 3:62485618-62485640 GGGGATGTTTCCCCAGATGAGGG - Intronic
957482270 3:80813564-80813586 GGAGTTGTTTCCCCAGTTACTGG - Intergenic
960150995 3:114248652-114248674 GTTGCTGTTTTCCCAGTCCTTGG - Intergenic
961226340 3:125251719-125251741 TGGGTTGTTTCCTCAGTTTTTGG + Intronic
961516524 3:127440953-127440975 GTGCCTGTTTCCCCACTCCTTGG - Intergenic
961572004 3:127806013-127806035 CAGGCTGTCTCCCCAATTCTTGG + Intronic
964139480 3:153380513-153380535 ATTGCTGTTTCCCCAGTGCTAGG + Intergenic
964972788 3:162581863-162581885 GGGGCTTTTTCCCCTTTGCTCGG + Intergenic
967946585 3:194808950-194808972 TGGGCAGTTTGCCCAGTTCTAGG - Intergenic
968508250 4:982336-982358 GGGGCGGCTTCCCCTGTCCTCGG + Intronic
968840050 4:2996741-2996763 GTGGCAGTTTCCCCAGTTGATGG - Intronic
969568651 4:7995268-7995290 GGGGGTGTCACCCCAGTACTGGG + Intronic
970544347 4:17112151-17112173 TGGGCTGTTCTCCAAGTTCTAGG - Intergenic
970883703 4:20962230-20962252 GGGGATGGATCCCCAGTTCACGG - Intronic
972032525 4:34479012-34479034 GTGGCTGTCTCCGCAGTCCTGGG + Intergenic
975343940 4:73272846-73272868 GTGATTCTTTCCCCAGTTCTGGG + Intergenic
977606025 4:98985859-98985881 GCTGCTGTTTCCCCATTACTAGG - Intergenic
978765924 4:112405026-112405048 GTGGCTTTTTCCCCAGCTTTGGG + Intronic
978770105 4:112447127-112447149 GGAGCAGATTCCCCAGTCCTGGG - Intergenic
979923509 4:126530120-126530142 GGCCCTGTTTCCTCAGTTCAGGG - Intergenic
982247942 4:153373351-153373373 GGGGCTGATTCAGCATTTCTTGG + Intronic
983855373 4:172637042-172637064 TTGGCTGTTTACCCAGTTTTTGG - Intronic
984348533 4:178562466-178562488 GGGGCTCTTTCCCCTTTGCTTGG - Intergenic
984396884 4:179213125-179213147 GTGGATATTTCCCCAGTTTTTGG + Intergenic
990489571 5:56290977-56290999 AGGGCTGTTACCCAAGTTGTTGG - Intergenic
991032982 5:62101664-62101686 GGGGCTGTGTGACCAGTTATTGG - Intergenic
991999931 5:72426230-72426252 GGGTCTGTTTCCCCAGCCCCAGG - Intergenic
995266756 5:110171216-110171238 GGGGCTTTTTCCCCTTTTCTTGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997213882 5:132094771-132094793 GGGTCTGTTTGCCCAGAGCTGGG - Intergenic
997253905 5:132411836-132411858 GGGGCTGTTTCCACAGCCCTGGG - Intronic
997593372 5:135089672-135089694 GGGGCTTTTTCCCCTTTGCTCGG + Intronic
998621657 5:143801095-143801117 GGGGGTATTTGCCTAGTTCTAGG + Intergenic
1000012135 5:157242955-157242977 GGCACTCTTTCCCCAGTGCTTGG - Intronic
1000435288 5:161200415-161200437 TGGATTGATTCCCCAGTTCTTGG + Intergenic
1000871089 5:166578624-166578646 GGCATTGTTTCCCCAGTTCTTGG - Intergenic
1001083930 5:168686857-168686879 GTGGCTGTAGCCCCGGTTCTGGG - Intronic
1001889234 5:175325178-175325200 GGGGCTGTTTCCCCTTTGCTCGG + Intergenic
1002078036 5:176720971-176720993 GTGGCTGTTTCCCCAGGGCCAGG - Intergenic
1009304273 6:62068166-62068188 GGGACTGTTTTTCCACTTCTCGG + Intronic
1010046972 6:71456480-71456502 GGGGCGGTTTCCCCCATGCTGGG - Intergenic
1010348823 6:74846976-74846998 GGGGATGTTTCTCGAGTTGTTGG + Intergenic
1011500202 6:87979841-87979863 GGGGATGTTTTCCCTTTTCTTGG + Intergenic
1012609704 6:101201409-101201431 GGGTGTGATTCCCCAGTCCTGGG - Intergenic
1015264867 6:131280702-131280724 GGGGCTCCTTCCCCAGTTAAGGG - Intronic
1017057609 6:150452354-150452376 GGAGCTGTTTCTCCAGCTCAGGG + Intergenic
1018827062 6:167416076-167416098 GGTCCTGTTTTCCCTGTTCTGGG - Intergenic
1018855296 6:167670293-167670315 GGGGCTGTGTCACCAGCCCTGGG - Intergenic
1018928487 6:168223335-168223357 GGGGCTGTCACCCCAGAACTGGG + Intergenic
1019447672 7:1079795-1079817 AGGGCTGCTTCCCCAGAGCTGGG - Intronic
1020942755 7:14561903-14561925 GAGACAGTTTCCCCATTTCTTGG - Intronic
1021056627 7:16056195-16056217 GGGGCTCTTTCCCCTTTGCTTGG - Intergenic
1021450475 7:20779038-20779060 GGGGCTTTATTCCGAGTTCTAGG + Intergenic
1022947755 7:35304180-35304202 GTGGCTGTGTCCACAGCTCTTGG - Intergenic
1024186162 7:46950171-46950193 GCGGCAGTTTCTCCAGTTCCTGG - Intergenic
1029710680 7:102297725-102297747 GCGGCTGTGTCCTCAGTGCTGGG - Intronic
1029715386 7:102322591-102322613 GGGTCTGTGACCCCAGGTCTGGG - Intergenic
1030995873 7:116357824-116357846 GGGGATGTTTTCCCAGTTTCTGG + Intronic
1031415999 7:121497264-121497286 GGGGCTGGTTCCCCAGATAATGG - Intergenic
1032390263 7:131551360-131551382 GGAGCTCTTTACCCAGCTCTGGG - Intronic
1032636384 7:133713735-133713757 GGGGCTCTTTCCCCATCGCTTGG + Intronic
1034839283 7:154380827-154380849 ATCCCTGTTTCCCCAGTTCTGGG + Intronic
1034884313 7:154786521-154786543 GGGGCTTTTTCCCCTTTGCTGGG + Intronic
1035955653 8:4076216-4076238 GGGGCTTTTCCCCCGTTTCTTGG + Intronic
1036387554 8:8295375-8295397 AGGCCTGTTTCCCCACCTCTGGG + Intergenic
1036657498 8:10686854-10686876 TGGGCTGGGTCCCCAGTTATGGG - Intronic
1037763358 8:21756699-21756721 GGGGCTGTAGCCCCAGTGCCAGG - Intronic
1046153304 8:110256435-110256457 GGGGCAGGTTCCCCAGTAATTGG - Intergenic
1047076858 8:121413830-121413852 GTGGTTCTTTCCCCAGTTGTTGG - Intergenic
1047573568 8:126129251-126129273 CTGTCTGTTTCTCCAGTTCTGGG - Intergenic
1048845846 8:138603021-138603043 GGGGCTCTTTTCCCATCTCTTGG + Intronic
1049064284 8:140300823-140300845 GTGGCTGCTCCCCCAGTTCCAGG - Intronic
1050773737 9:9235156-9235178 GGGGCTTTTCCCCCATTGCTTGG - Intronic
1052006134 9:23351071-23351093 GGGTCTGTTTACTCAGTCCTTGG - Intergenic
1052855715 9:33404955-33404977 GGGGCTGTTGCCCCAGAGTTGGG + Intergenic
1054802034 9:69359508-69359530 GGGGCTGTTTCCCCTTCACTTGG + Intronic
1055189378 9:73498717-73498739 GGGGCTGTTCCCCCTTTGCTTGG + Intergenic
1055272581 9:74577905-74577927 GAGACTGTCTCCACAGTTCTCGG + Intronic
1056812772 9:89777108-89777130 GGGGCTCTCTCCTCAGTTCCTGG + Intergenic
1057233167 9:93337481-93337503 GGGGCTCTTTCCCCTTTGCTCGG + Intronic
1060191651 9:121597939-121597961 GGGGCTGAGACCCCATTTCTGGG + Intronic
1061685032 9:132268934-132268956 GTGGCTGTTTCCCCTGGTTTTGG - Intronic
1062735552 9:138135411-138135433 GTGGGTGTTTCTCCAGTGCTGGG + Intergenic
1186635711 X:11402197-11402219 GGATCTGATTCCCAAGTTCTTGG + Intronic
1187612209 X:20955134-20955156 GGGGCTGTGTCCCCAGAGCTGGG + Intergenic
1192310344 X:70007455-70007477 GGGGCTTTTTCCCCTTTGCTCGG + Intronic
1192543558 X:71994813-71994835 GGAGCTGTGTCCCCAGTGCCTGG + Intergenic
1192640250 X:72855599-72855621 GGGGCTGTTTTCTAAGTTGTAGG + Intergenic
1192641461 X:72865177-72865199 GGGGCTGTTTTCTAAGTTGTAGG - Intergenic
1192824369 X:74679749-74679771 CTGGTTATTTCCCCAGTTCTGGG + Intergenic
1198874371 X:141207086-141207108 GAGGCAGTTTCCCCTGTTCTTGG - Intergenic