ID: 1124045800

View in Genome Browser
Species Human (GRCh38)
Location 15:26148794-26148816
Sequence GGAGAAGGAATCAAGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124045800_1124045809 22 Left 1124045800 15:26148794-26148816 CCCTCTGGCTTGATTCCTTCTCC No data
Right 1124045809 15:26148839-26148861 CTTCTTATAGCTTTCCCTGTAGG No data
1124045800_1124045811 24 Left 1124045800 15:26148794-26148816 CCCTCTGGCTTGATTCCTTCTCC No data
Right 1124045811 15:26148841-26148863 TCTTATAGCTTTCCCTGTAGGGG No data
1124045800_1124045812 25 Left 1124045800 15:26148794-26148816 CCCTCTGGCTTGATTCCTTCTCC No data
Right 1124045812 15:26148842-26148864 CTTATAGCTTTCCCTGTAGGGGG No data
1124045800_1124045810 23 Left 1124045800 15:26148794-26148816 CCCTCTGGCTTGATTCCTTCTCC No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124045800 Original CRISPR GGAGAAGGAATCAAGCCAGA GGG (reversed) Intergenic
No off target data available for this crispr