ID: 1124045802

View in Genome Browser
Species Human (GRCh38)
Location 15:26148809-26148831
Sequence AAGCAGAAGAGGGAAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124045802_1124045811 9 Left 1124045802 15:26148809-26148831 CCTTCTCCTTCCCTCTTCTGCTT No data
Right 1124045811 15:26148841-26148863 TCTTATAGCTTTCCCTGTAGGGG No data
1124045802_1124045809 7 Left 1124045802 15:26148809-26148831 CCTTCTCCTTCCCTCTTCTGCTT No data
Right 1124045809 15:26148839-26148861 CTTCTTATAGCTTTCCCTGTAGG No data
1124045802_1124045810 8 Left 1124045802 15:26148809-26148831 CCTTCTCCTTCCCTCTTCTGCTT No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045802_1124045812 10 Left 1124045802 15:26148809-26148831 CCTTCTCCTTCCCTCTTCTGCTT No data
Right 1124045812 15:26148842-26148864 CTTATAGCTTTCCCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124045802 Original CRISPR AAGCAGAAGAGGGAAGGAGA AGG (reversed) Intergenic
No off target data available for this crispr