ID: 1124045810

View in Genome Browser
Species Human (GRCh38)
Location 15:26148840-26148862
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124045804_1124045810 -2 Left 1124045804 15:26148819-26148841 CCCTCTTCTGCTTCCCATGCCTT No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045801_1124045810 22 Left 1124045801 15:26148795-26148817 CCTCTGGCTTGATTCCTTCTCCT No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045800_1124045810 23 Left 1124045800 15:26148794-26148816 CCCTCTGGCTTGATTCCTTCTCC No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045803_1124045810 2 Left 1124045803 15:26148815-26148837 CCTTCCCTCTTCTGCTTCCCATG No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045805_1124045810 -3 Left 1124045805 15:26148820-26148842 CCTCTTCTGCTTCCCATGCCTTC No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data
1124045802_1124045810 8 Left 1124045802 15:26148809-26148831 CCTTCTCCTTCCCTCTTCTGCTT No data
Right 1124045810 15:26148840-26148862 TTCTTATAGCTTTCCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124045810 Original CRISPR TTCTTATAGCTTTCCCTGTA GGG Intergenic
No off target data available for this crispr