ID: 1124046675

View in Genome Browser
Species Human (GRCh38)
Location 15:26156818-26156840
Sequence CTGGAGCCACAAGTGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124046675_1124046681 25 Left 1124046675 15:26156818-26156840 CCAGTTTCCACTTGTGGCTCCAG No data
Right 1124046681 15:26156866-26156888 TGTTGTAAAGAAAACCTCACGGG No data
1124046675_1124046680 24 Left 1124046675 15:26156818-26156840 CCAGTTTCCACTTGTGGCTCCAG No data
Right 1124046680 15:26156865-26156887 TTGTTGTAAAGAAAACCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124046675 Original CRISPR CTGGAGCCACAAGTGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr