ID: 1124047253

View in Genome Browser
Species Human (GRCh38)
Location 15:26161710-26161732
Sequence CAGCAGTACCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124047253_1124047257 -2 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047257 15:26161731-26161753 TGGCATGAGCTGCAAAGCCCTGG No data
1124047253_1124047261 10 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047261 15:26161743-26161765 CAAAGCCCTGGGTGCTAGGGCGG No data
1124047253_1124047259 6 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047259 15:26161739-26161761 GCTGCAAAGCCCTGGGTGCTAGG No data
1124047253_1124047264 19 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047264 15:26161752-26161774 GGGTGCTAGGGCGGTTGTGATGG No data
1124047253_1124047258 -1 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047258 15:26161732-26161754 GGCATGAGCTGCAAAGCCCTGGG No data
1124047253_1124047260 7 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047260 15:26161740-26161762 CTGCAAAGCCCTGGGTGCTAGGG No data
1124047253_1124047265 23 Left 1124047253 15:26161710-26161732 CCTTCCTCCTGCTGGTACTGCTG No data
Right 1124047265 15:26161756-26161778 GCTAGGGCGGTTGTGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124047253 Original CRISPR CAGCAGTACCAGCAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr