ID: 1124048683

View in Genome Browser
Species Human (GRCh38)
Location 15:26175300-26175322
Sequence CTGTGGGGATAGTTCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124048676_1124048683 12 Left 1124048676 15:26175265-26175287 CCGGCCTAGAACTTGTAATGCAA No data
Right 1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG No data
1124048673_1124048683 21 Left 1124048673 15:26175256-26175278 CCACCTTGCCCGGCCTAGAACTT No data
Right 1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG No data
1124048674_1124048683 18 Left 1124048674 15:26175259-26175281 CCTTGCCCGGCCTAGAACTTGTA No data
Right 1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG No data
1124048677_1124048683 8 Left 1124048677 15:26175269-26175291 CCTAGAACTTGTAATGCAATTAT No data
Right 1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG No data
1124048675_1124048683 13 Left 1124048675 15:26175264-26175286 CCCGGCCTAGAACTTGTAATGCA No data
Right 1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124048683 Original CRISPR CTGTGGGGATAGTTCCAAAA AGG Intergenic
No off target data available for this crispr