ID: 1124049304

View in Genome Browser
Species Human (GRCh38)
Location 15:26180211-26180233
Sequence GGTACTCAAATACATGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124049304_1124049313 14 Left 1124049304 15:26180211-26180233 CCCAGGACATGTATTTGAGTACC No data
Right 1124049313 15:26180248-26180270 GGATCTGCAAGCGCATGGAGTGG No data
1124049304_1124049314 18 Left 1124049304 15:26180211-26180233 CCCAGGACATGTATTTGAGTACC No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data
1124049304_1124049312 9 Left 1124049304 15:26180211-26180233 CCCAGGACATGTATTTGAGTACC No data
Right 1124049312 15:26180243-26180265 CCAGAGGATCTGCAAGCGCATGG No data
1124049304_1124049308 -7 Left 1124049304 15:26180211-26180233 CCCAGGACATGTATTTGAGTACC No data
Right 1124049308 15:26180227-26180249 GAGTACCCATGGAGGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124049304 Original CRISPR GGTACTCAAATACATGTCCT GGG (reversed) Intergenic
No off target data available for this crispr