ID: 1124049310

View in Genome Browser
Species Human (GRCh38)
Location 15:26180233-26180255
Sequence GCAGATCCTCTGGTCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124049310_1124049313 -8 Left 1124049310 15:26180233-26180255 CCATGGAGGACCAGAGGATCTGC No data
Right 1124049313 15:26180248-26180270 GGATCTGCAAGCGCATGGAGTGG No data
1124049310_1124049314 -4 Left 1124049310 15:26180233-26180255 CCATGGAGGACCAGAGGATCTGC No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data
1124049310_1124049315 14 Left 1124049310 15:26180233-26180255 CCATGGAGGACCAGAGGATCTGC No data
Right 1124049315 15:26180270-26180292 GCTGGACCCTGCCTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124049310 Original CRISPR GCAGATCCTCTGGTCCTCCA TGG (reversed) Intergenic
No off target data available for this crispr