ID: 1124049314

View in Genome Browser
Species Human (GRCh38)
Location 15:26180252-26180274
Sequence CTGCAAGCGCATGGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124049304_1124049314 18 Left 1124049304 15:26180211-26180233 CCCAGGACATGTATTTGAGTACC No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data
1124049310_1124049314 -4 Left 1124049310 15:26180233-26180255 CCATGGAGGACCAGAGGATCTGC No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data
1124049309_1124049314 -3 Left 1124049309 15:26180232-26180254 CCCATGGAGGACCAGAGGATCTG No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data
1124049305_1124049314 17 Left 1124049305 15:26180212-26180234 CCAGGACATGTATTTGAGTACCC No data
Right 1124049314 15:26180252-26180274 CTGCAAGCGCATGGAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124049314 Original CRISPR CTGCAAGCGCATGGAGTGGC TGG Intergenic