ID: 1124049315

View in Genome Browser
Species Human (GRCh38)
Location 15:26180270-26180292
Sequence GCTGGACCCTGCCTTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124049311_1124049315 4 Left 1124049311 15:26180243-26180265 CCAGAGGATCTGCAAGCGCATGG No data
Right 1124049315 15:26180270-26180292 GCTGGACCCTGCCTTCCCAGAGG No data
1124049310_1124049315 14 Left 1124049310 15:26180233-26180255 CCATGGAGGACCAGAGGATCTGC No data
Right 1124049315 15:26180270-26180292 GCTGGACCCTGCCTTCCCAGAGG No data
1124049309_1124049315 15 Left 1124049309 15:26180232-26180254 CCCATGGAGGACCAGAGGATCTG No data
Right 1124049315 15:26180270-26180292 GCTGGACCCTGCCTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124049315 Original CRISPR GCTGGACCCTGCCTTCCCAG AGG Intergenic