ID: 1124050927

View in Genome Browser
Species Human (GRCh38)
Location 15:26197124-26197146
Sequence CTCTTCAGTGAAGGGTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124050922_1124050927 -9 Left 1124050922 15:26197110-26197132 CCACACTAGTCCTACTCTTCAGT No data
Right 1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG No data
1124050920_1124050927 1 Left 1124050920 15:26197100-26197122 CCCTTGCTCTCCACACTAGTCCT No data
Right 1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG No data
1124050921_1124050927 0 Left 1124050921 15:26197101-26197123 CCTTGCTCTCCACACTAGTCCTA No data
Right 1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG No data
1124050919_1124050927 2 Left 1124050919 15:26197099-26197121 CCCCTTGCTCTCCACACTAGTCC No data
Right 1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124050927 Original CRISPR CTCTTCAGTGAAGGGTAGAA GGG Intergenic
No off target data available for this crispr