ID: 1124052513

View in Genome Browser
Species Human (GRCh38)
Location 15:26210879-26210901
Sequence CTCCAGCAGCAGACAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124052509_1124052513 10 Left 1124052509 15:26210846-26210868 CCAGCAGGAGTCATAGCAAGTGA No data
Right 1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG No data
1124052508_1124052513 11 Left 1124052508 15:26210845-26210867 CCCAGCAGGAGTCATAGCAAGTG No data
Right 1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG No data
1124052507_1124052513 21 Left 1124052507 15:26210835-26210857 CCAACTGAAACCCAGCAGGAGTC No data
Right 1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG No data
1124052505_1124052513 29 Left 1124052505 15:26210827-26210849 CCTTGATTCCAACTGAAACCCAG No data
Right 1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124052513 Original CRISPR CTCCAGCAGCAGACAGGCAA AGG Intergenic
No off target data available for this crispr