ID: 1124055396

View in Genome Browser
Species Human (GRCh38)
Location 15:26237177-26237199
Sequence GGCTGCAAAAAGTTTAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124055389_1124055396 14 Left 1124055389 15:26237140-26237162 CCAGGATGGAGAACTGCTGCCCA No data
Right 1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG No data
1124055393_1124055396 -6 Left 1124055393 15:26237160-26237182 CCAAAGGCAACTCAAGTGGCTGC No data
Right 1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG No data
1124055388_1124055396 25 Left 1124055388 15:26237129-26237151 CCATGACTCAGCCAGGATGGAGA No data
Right 1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG No data
1124055392_1124055396 -5 Left 1124055392 15:26237159-26237181 CCCAAAGGCAACTCAAGTGGCTG No data
Right 1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124055396 Original CRISPR GGCTGCAAAAAGTTTAGGAT GGG Intergenic
No off target data available for this crispr