ID: 1124056833

View in Genome Browser
Species Human (GRCh38)
Location 15:26248631-26248653
Sequence TTCTAGCTAGAGCAATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124056833_1124056835 11 Left 1124056833 15:26248631-26248653 CCACCTAATTGCTCTAGCTAGAA No data
Right 1124056835 15:26248665-26248687 ATGTTAAATAGAAATCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124056833 Original CRISPR TTCTAGCTAGAGCAATTAGG TGG (reversed) Intergenic
No off target data available for this crispr