ID: 1124065783

View in Genome Browser
Species Human (GRCh38)
Location 15:26342442-26342464
Sequence GAATCACTTGTAGGGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124065783_1124065787 15 Left 1124065783 15:26342442-26342464 CCATGGCTCCCTACAAGTGATTC No data
Right 1124065787 15:26342480-26342502 CATGATCCTGTTAACAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124065783 Original CRISPR GAATCACTTGTAGGGAGCCA TGG (reversed) Intergenic
No off target data available for this crispr