ID: 1124065911

View in Genome Browser
Species Human (GRCh38)
Location 15:26343529-26343551
Sequence CCTACTCCAGCTCATGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124065911_1124065914 4 Left 1124065911 15:26343529-26343551 CCTCAATCATGAGCTGGAGTAGG No data
Right 1124065914 15:26343556-26343578 TACCATGAAATTTATTAGGAAGG No data
1124065911_1124065913 0 Left 1124065911 15:26343529-26343551 CCTCAATCATGAGCTGGAGTAGG No data
Right 1124065913 15:26343552-26343574 AAAGTACCATGAAATTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124065911 Original CRISPR CCTACTCCAGCTCATGATTG AGG (reversed) Intergenic
No off target data available for this crispr