ID: 1124071009

View in Genome Browser
Species Human (GRCh38)
Location 15:26393276-26393298
Sequence CATGCTAGGCTGTGAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124071002_1124071009 13 Left 1124071002 15:26393240-26393262 CCTAGGTGGGAGCGGGTCCTTCT No data
Right 1124071009 15:26393276-26393298 CATGCTAGGCTGTGAGCCCATGG No data
1124071006_1124071009 -4 Left 1124071006 15:26393257-26393279 CCTTCTGTGGTGGCATGGCCATG No data
Right 1124071009 15:26393276-26393298 CATGCTAGGCTGTGAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124071009 Original CRISPR CATGCTAGGCTGTGAGCCCA TGG Intergenic
No off target data available for this crispr