ID: 1124071245

View in Genome Browser
Species Human (GRCh38)
Location 15:26394892-26394914
Sequence TCTGGGGCCCAGAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124071245_1124071258 23 Left 1124071245 15:26394892-26394914 CCTGCCTGCTTCTGGGCCCCAGA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071245_1124071253 4 Left 1124071245 15:26394892-26394914 CCTGCCTGCTTCTGGGCCCCAGA No data
Right 1124071253 15:26394919-26394941 CCCCCATCCACTTGTGATCTGGG No data
1124071245_1124071251 3 Left 1124071245 15:26394892-26394914 CCTGCCTGCTTCTGGGCCCCAGA No data
Right 1124071251 15:26394918-26394940 ACCCCCATCCACTTGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124071245 Original CRISPR TCTGGGGCCCAGAAGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr