ID: 1124071251

View in Genome Browser
Species Human (GRCh38)
Location 15:26394918-26394940
Sequence ACCCCCATCCACTTGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124071241_1124071251 18 Left 1124071241 15:26394877-26394899 CCTAGGGAGTCAGACCCTGCCTG No data
Right 1124071251 15:26394918-26394940 ACCCCCATCCACTTGTGATCTGG No data
1124071246_1124071251 -1 Left 1124071246 15:26394896-26394918 CCTGCTTCTGGGCCCCAGAGCCA No data
Right 1124071251 15:26394918-26394940 ACCCCCATCCACTTGTGATCTGG No data
1124071245_1124071251 3 Left 1124071245 15:26394892-26394914 CCTGCCTGCTTCTGGGCCCCAGA No data
Right 1124071251 15:26394918-26394940 ACCCCCATCCACTTGTGATCTGG No data
1124071244_1124071251 4 Left 1124071244 15:26394891-26394913 CCCTGCCTGCTTCTGGGCCCCAG No data
Right 1124071251 15:26394918-26394940 ACCCCCATCCACTTGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124071251 Original CRISPR ACCCCCATCCACTTGTGATC TGG Intergenic
No off target data available for this crispr