ID: 1124071258

View in Genome Browser
Species Human (GRCh38)
Location 15:26394938-26394960
Sequence TGGGAAAGTCATTTAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124071256_1124071258 -7 Left 1124071256 15:26394922-26394944 CCATCCACTTGTGATCTGGGAAA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071255_1124071258 -6 Left 1124071255 15:26394921-26394943 CCCATCCACTTGTGATCTGGGAA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071246_1124071258 19 Left 1124071246 15:26394896-26394918 CCTGCTTCTGGGCCCCAGAGCCA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071250_1124071258 -1 Left 1124071250 15:26394916-26394938 CCACCCCCATCCACTTGTGATCT No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071252_1124071258 -4 Left 1124071252 15:26394919-26394941 CCCCCATCCACTTGTGATCTGGG No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071244_1124071258 24 Left 1124071244 15:26394891-26394913 CCCTGCCTGCTTCTGGGCCCCAG No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071254_1124071258 -5 Left 1124071254 15:26394920-26394942 CCCCATCCACTTGTGATCTGGGA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071247_1124071258 7 Left 1124071247 15:26394908-26394930 CCCCAGAGCCACCCCCATCCACT No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071249_1124071258 5 Left 1124071249 15:26394910-26394932 CCAGAGCCACCCCCATCCACTTG No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071245_1124071258 23 Left 1124071245 15:26394892-26394914 CCTGCCTGCTTCTGGGCCCCAGA No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data
1124071248_1124071258 6 Left 1124071248 15:26394909-26394931 CCCAGAGCCACCCCCATCCACTT No data
Right 1124071258 15:26394938-26394960 TGGGAAAGTCATTTAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124071258 Original CRISPR TGGGAAAGTCATTTAACACC AGG Intergenic
No off target data available for this crispr