ID: 1124086328

View in Genome Browser
Species Human (GRCh38)
Location 15:26553745-26553767
Sequence TGTGCTCCTGACTAAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124086328_1124086333 10 Left 1124086328 15:26553745-26553767 CCCTGTCCTTAGTCAGGAGCACA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1124086333 15:26553778-26553800 AAGAAGGTCCTCACCCTCAAGGG 0: 1
1: 0
2: 0
3: 24
4: 237
1124086328_1124086331 -6 Left 1124086328 15:26553745-26553767 CCCTGTCCTTAGTCAGGAGCACA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1124086331 15:26553762-26553784 AGCACAAAGTGAACACAAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 295
1124086328_1124086334 11 Left 1124086328 15:26553745-26553767 CCCTGTCCTTAGTCAGGAGCACA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1124086334 15:26553779-26553801 AGAAGGTCCTCACCCTCAAGGGG 0: 1
1: 0
2: 1
3: 15
4: 152
1124086328_1124086332 9 Left 1124086328 15:26553745-26553767 CCCTGTCCTTAGTCAGGAGCACA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1124086332 15:26553777-26553799 CAAGAAGGTCCTCACCCTCAAGG 0: 1
1: 0
2: 4
3: 28
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124086328 Original CRISPR TGTGCTCCTGACTAAGGACA GGG (reversed) Intronic
902246366 1:15123559-15123581 TGAGCTCCTGACTTAAAACAAGG + Intergenic
902843960 1:19094905-19094927 TGAGCCCCTGAGTGAGGACAAGG - Exonic
902994220 1:20211319-20211341 TGTGCTCCTGACCAGAGACCTGG - Intergenic
905973186 1:42156108-42156130 TGTGCTCCTGACGCAGGAGTGGG + Intergenic
906009785 1:42512407-42512429 TGCTCTCCAGACTAAGGGCAGGG + Intronic
906687500 1:47772015-47772037 TGTGCTACTGTGTCAGGACAGGG + Intronic
907004496 1:50897187-50897209 TGTGTTCCTGTCTATGAACATGG - Intronic
909856738 1:80543434-80543456 TGTGCTCCTGACACAGGAATAGG + Intergenic
910770872 1:90831189-90831211 GGTGTTCCTGACTAAAGCCAGGG + Intergenic
911126375 1:94344475-94344497 TTTTCTCCTCACTAAGGGCAAGG - Intergenic
915034345 1:152909833-152909855 GGAGCTCCTGACTGAGGGCAGGG - Exonic
915554079 1:156651792-156651814 TGAGCTACTGAGAAAGGACAGGG - Intronic
915907787 1:159891637-159891659 TGTGCTCCTGACCAGAGGCAGGG + Intronic
916853648 1:168728051-168728073 TGAGCTCCTGACCAAGCACCTGG + Intronic
918760503 1:188398629-188398651 TGTGCTCCTGAATAAGCAATGGG + Intergenic
921798469 1:219374952-219374974 TATGCTGCTGAATAAGGAGATGG - Intergenic
921948005 1:220900977-220900999 TGTGCTCTTGACTAAGGCATTGG + Intergenic
922025738 1:221746835-221746857 TGTGCTTGTGACTCAGGAAAAGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064070378 10:12223792-12223814 TTTGCTTCTGAGTAAAGACAAGG + Intronic
1070069851 10:73077126-73077148 TGGGCTCCTGCCAAAGCACAAGG + Intronic
1070587802 10:77779861-77779883 TGAGCTCCTGACCTAGGCCAAGG - Intergenic
1070712227 10:78691137-78691159 TGTGCTCCTGGCTCAGGGCCTGG + Intergenic
1070963092 10:80512587-80512609 TCTGCTCCAGAAAAAGGACAGGG - Intronic
1073568643 10:104557148-104557170 GGTGATACTGACTAAGGGCATGG + Intergenic
1075162603 10:120037767-120037789 TATGCCCCTTACTAAGTACATGG - Intergenic
1077600713 11:3572578-3572600 TTAGCTCCTGCCTAAGCACAGGG - Intergenic
1079984844 11:27189534-27189556 TGGGGTCCTGACTAGGGACTGGG - Intergenic
1080590882 11:33722353-33722375 AGTGCTCCAGTCTCAGGACATGG - Intronic
1081977623 11:47245681-47245703 TGTGCCCATCACTGAGGACAGGG - Exonic
1082261966 11:50083333-50083355 AGTGGTCCTGACTAGGGTCATGG - Intergenic
1085381662 11:76125356-76125378 TGTGTTCCTGTCTAGAGACAAGG - Intronic
1087697105 11:101391989-101392011 TGTGCTGCTGGCTAGGGAAAGGG + Intergenic
1088393566 11:109342671-109342693 TTTGCTACTGACTAAGTATATGG - Intergenic
1088988441 11:114929681-114929703 TGGGCTCCTGACCTAGGCCAGGG + Intergenic
1089934943 11:122354813-122354835 TGTGATCCAGACAGAGGACAGGG - Intergenic
1090130553 11:124137045-124137067 CTTGCTCCAGACCAAGGACATGG + Exonic
1091873376 12:3913572-3913594 GGTGATCCTTACTAAGGACTGGG + Intergenic
1092052113 12:5479282-5479304 TGTCCTCTTGACTAGGGAGATGG - Intronic
1092195121 12:6544755-6544777 TGTGCTGCTAGCTAAAGACATGG - Intronic
1092264048 12:6967805-6967827 GGGGCTCCTGACCCAGGACAGGG - Intronic
1093901901 12:24645118-24645140 TTTTTTCCTGGCTAAGGACATGG + Intergenic
1098428763 12:70396175-70396197 GGAGCTCCTGATTTAGGACAAGG - Intronic
1099907092 12:88784390-88784412 TGTGCTTCTGACAGAGGAAAGGG + Intergenic
1100000949 12:89834750-89834772 TTTCTTCCTGCCTAAGGACATGG + Intergenic
1100659574 12:96682230-96682252 AGTGCTCCTGAGAAAGGTCAGGG - Intronic
1102232422 12:111272820-111272842 GGTGCTCCTGGCTGAGGAAACGG - Intronic
1102399133 12:112613455-112613477 TGGGCTCCAGAATTAGGACATGG - Intronic
1106688404 13:32086962-32086984 TGTGCTCCTAACTCAGCACAGGG - Intronic
1108302769 13:49096128-49096150 TGTGCTCCTGACTGTGGTTATGG + Intronic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1112466112 13:99646409-99646431 TGTGCTCCTCACCAGGGAGAAGG + Intronic
1113347830 13:109497922-109497944 TTTGCTCCTGAGTAAGTACAGGG + Intergenic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1119784397 14:77301488-77301510 AGTGCTCCTGGCTAAGTACAGGG + Intronic
1120559387 14:85972297-85972319 TGTGCTCCTGAATGACTACAGGG - Intergenic
1121408135 14:93731769-93731791 TGTGCTGGGGACTAAGCACAAGG - Intronic
1122285138 14:100646794-100646816 TGAGGTTCTGGCTAAGGACAGGG - Intergenic
1122378906 14:101287570-101287592 TGTGCTCCTTGCTCAGGGCAGGG + Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124495526 15:30184409-30184431 TGTGCTCCAGAGCAGGGACAGGG + Intergenic
1124748047 15:32354237-32354259 TGTGCTCCAGAGCAGGGACAGGG - Intergenic
1124808411 15:32909151-32909173 TGAGCTCAGGACTAAGCACATGG - Intronic
1124896400 15:33781182-33781204 TGTGATCCTGCCTAAGGATAAGG + Intronic
1125450324 15:39800899-39800921 TGTGGACTTCACTAAGGACATGG + Exonic
1126085873 15:45010912-45010934 TGGCCACCTGACTAAAGACACGG + Intergenic
1130923095 15:88365498-88365520 TGTGCTCATGACAAACGTCAAGG + Intergenic
1132556722 16:575856-575878 TTTGCTCCCGAGGAAGGACAGGG - Exonic
1138551566 16:57751625-57751647 TGTGCCCCTGAGGGAGGACACGG - Exonic
1139136960 16:64216188-64216210 TATTCTCCTGCCTAAGCACAAGG - Intergenic
1140204376 16:72921791-72921813 TCTCCTCCTGGCTCAGGACAAGG - Intronic
1141329341 16:83094471-83094493 TGTTGTCCTTACTCAGGACAAGG + Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1142760205 17:2037511-2037533 TGTGGGCCTGTCTAGGGACAGGG - Intronic
1147052141 17:37803245-37803267 TTTGCTCCTGGCTAATGCCATGG + Intergenic
1151356328 17:73560835-73560857 TGTGCTCCTGAATCAGGATCGGG - Intronic
1152209750 17:78996815-78996837 TATGCTCCTGGCTAAGGGTAAGG + Intronic
1156270033 18:35522167-35522189 TGTGCTGGGGACTAAGAACAAGG + Intergenic
1159115456 18:64108034-64108056 TGTGCTACTGATTAAGGTAAAGG + Intergenic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163125571 19:15242650-15242672 CGTGCTCCTGACTCAAGAGAGGG + Intronic
1164871668 19:31650603-31650625 TGTGCACGTGACTATGGAGAAGG - Intergenic
1166159904 19:40944695-40944717 TGTGATCCTTCCTCAGGACACGG + Intergenic
1166925098 19:46261538-46261560 TGTCCTCCTTACCCAGGACATGG + Intergenic
1167356843 19:49009850-49009872 TGAGTCCCTGACCAAGGACAAGG + Exonic
925325277 2:3014985-3015007 CGTGCTCCTGACTAACCAAATGG + Intergenic
925663570 2:6228578-6228600 TGTGCTCCTGTTTAAGGCCGGGG - Intergenic
929311309 2:40429206-40429228 TTTGCTGCTGACTTAGGACTTGG + Exonic
931092249 2:58898813-58898835 TGTTCTCCTGAATAGGGACTAGG - Intergenic
932753807 2:74391302-74391324 TGTGGTTCTGTCTAAAGACAAGG + Intronic
935096012 2:99945075-99945097 TGTGCTCATGTCTAAGGGCCAGG - Intronic
935337154 2:102027023-102027045 TGTGTTCCAGCCTCAGGACAGGG + Intronic
936631318 2:114206168-114206190 AGTGTTTCTGACTTAGGACATGG + Intergenic
936904340 2:117519793-117519815 AGTTCTCCTGACTAAGGACTAGG + Intergenic
938314043 2:130314430-130314452 TGTGCTCCTGACTATGCACCTGG - Intergenic
941709400 2:168696225-168696247 AGTGCTCCTGACTGAAGACATGG + Intronic
945066195 2:205949666-205949688 TGGGCTCCTGACCTAGGCCATGG - Intergenic
945785783 2:214234780-214234802 TGTGGTCATGAATAAGGAAAAGG + Intronic
946507960 2:220321715-220321737 TGAGGTGCTGACTGAGGACAAGG + Intergenic
946688461 2:222294021-222294043 TCTGCGCCTGAGTAACGACATGG - Intronic
948080685 2:235202893-235202915 TGTGCTTCTGACAAAGGCCAAGG + Intergenic
948471152 2:238180586-238180608 TGTTCTCCTGCCTGAGGCCAGGG - Intronic
948589648 2:239040812-239040834 TGCCCACCTGACTAAGGCCAAGG + Intergenic
1169035748 20:2450640-2450662 TGTGCTTGTGATTAAGCACAAGG + Intergenic
1169135439 20:3194436-3194458 TGTGCTCCTGACTGGGAACTTGG - Intronic
1169531441 20:6489524-6489546 TGTGCTCCTCCCTAGGGCCAAGG + Intergenic
1171068898 20:22046819-22046841 TGTGCTGGTGACCTAGGACAGGG + Intergenic
1172199961 20:33118467-33118489 AGTGCTGCTGACTCAGGAGAGGG + Intergenic
1176308114 21:5134962-5134984 TGTGCCCCTGGGTAAGAACATGG - Intronic
1177922141 21:27165216-27165238 TTTTCTCCTGATTAAGGAGAAGG + Intergenic
1178163799 21:29949008-29949030 TGTGCTCATGTTTAAGGAAAGGG + Intergenic
1179117257 21:38505234-38505256 TGTGCTCCTGACTTCAGGCACGG - Intronic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1179848946 21:44127070-44127092 TGTGCCCCTGGGTAAGAACATGG + Intronic
1180541273 22:16450097-16450119 TTTGCTCCTGACTAACTACTGGG + Intergenic
1181372024 22:22426214-22426236 TGGGCTCCAGGCTGAGGACAAGG + Intergenic
1181460928 22:23085598-23085620 TGGGCTCCAGCCTGAGGACAAGG + Intronic
1182023927 22:27102610-27102632 TGTGCATCTGCCTAAGGACCTGG - Intergenic
1184132690 22:42526907-42526929 TCTGCTCCTGAATTAGGAGAAGG + Intergenic
1184497872 22:44853108-44853130 TGTTCTCCTGACTAAAAAAATGG - Intronic
952520569 3:34152843-34152865 TGTCCTGCTGACTGAGGACCTGG + Intergenic
952617981 3:35298611-35298633 TGTACTCCAGACTGAGCACAGGG - Intergenic
956673907 3:71716775-71716797 TGGGCTAATGACTAAGGGCATGG - Intronic
957071528 3:75571193-75571215 TAAGCTCCTGCCTAAGCACAGGG - Intergenic
958924515 3:100143341-100143363 TTTGCTCCTGACTGGGAACAAGG - Intronic
961282598 3:125775548-125775570 TTAGCTCCTGCCTAAGCACAGGG + Intergenic
961387880 3:126534518-126534540 TTTTCTCCTGGCTGAGGACAGGG - Intronic
961387915 3:126534770-126534792 TTTTCTCCTGGCTGAGGACAGGG - Intronic
965847621 3:172983018-172983040 TGTGATCCTGCCTAAAGGCAAGG - Intronic
966135317 3:176691690-176691712 TGTGGAGCTGACCAAGGACAGGG + Intergenic
968578531 4:1379047-1379069 TGTGCTCCTGTCTGTGGACCTGG + Intronic
969659046 4:8515682-8515704 GGTGCTCCTGACCAAGGAGCAGG + Intergenic
970003404 4:11387026-11387048 TGTGCTCAGGATTCAGGACATGG + Intergenic
979828877 4:125275838-125275860 TTTGCTCTTGACTTAGGCCAGGG + Intergenic
986486522 5:8243609-8243631 TGTGCTGCAGACTAAGGCCTGGG + Intergenic
986671457 5:10146581-10146603 TGCCCTCCTGGCTCAGGACAAGG - Intergenic
989098105 5:37799672-37799694 TGTGCTCCTGCCTCAGGACCTGG - Intergenic
989610887 5:43290361-43290383 TGTGCTCCTGAATCAGTTCATGG - Exonic
993004306 5:82414180-82414202 TGTGCTCCAGAGTGAGGGCATGG + Intergenic
995780536 5:115770537-115770559 TGAGCTCCAGCCTAAGGAGAAGG + Intergenic
995794943 5:115931187-115931209 TATACTCCTGACTTGGGACATGG - Intergenic
997592778 5:135086039-135086061 TGTGCTCCTGACTCCGGGCTGGG + Intronic
998707183 5:144776261-144776283 TGTGCTCATGGCTAAGGCTAGGG + Intergenic
999895239 5:156025331-156025353 TAAGGTCCTGACTAATGACAAGG + Intronic
1002200242 5:177524006-177524028 TGTGTTCCTGCCCAAGGACATGG - Exonic
1002956161 6:1867028-1867050 TATGCTCCTGACAAATTACATGG + Intronic
1008071575 6:47103828-47103850 TGCACTCCTGCCTAAGGACAGGG + Intergenic
1008366945 6:50692129-50692151 TGTGCTGTTTATTAAGGACAAGG - Intergenic
1010570086 6:77464607-77464629 TGTGACCATGGCTAAGGACATGG - Intergenic
1011572443 6:88753830-88753852 TGAGCTTCTTACTAGGGACAGGG + Intronic
1021831897 7:24621189-24621211 TGTGCACTTGACAAAGGAGAAGG - Intronic
1022768802 7:33446790-33446812 TGTGCTTCAGACAAAGGAAATGG - Intronic
1024532704 7:50406655-50406677 TGTGCTCCTGGCTGAGGAAATGG - Intergenic
1024757833 7:52557199-52557221 TGAGCTCCTGATTATTGACAGGG - Intergenic
1026580782 7:71615000-71615022 AGTGCTCCTCAAGAAGGACACGG + Intronic
1026958887 7:74396098-74396120 TGTGCTCCTGCCTATGCCCATGG + Intronic
1029073808 7:97920502-97920524 TTAGCTCCTGCCTAAGCACAGGG - Intergenic
1032018108 7:128392544-128392566 TGAGCTCCTGACCTAGGCCAAGG - Exonic
1032476960 7:132218078-132218100 TCTGCTCCTGTCTCAGGGCATGG + Intronic
1033097357 7:138442664-138442686 TGAGCTCCTGACCTAGGCCAAGG + Intergenic
1035392868 7:158517159-158517181 TGTGGTCCTCACTGAAGACAGGG + Intronic
1038044013 8:23750764-23750786 TGTCCTCCTGATAAAGCACATGG + Intergenic
1045655547 8:104383071-104383093 TGTCCTCCTCACTCAGAACAGGG + Intronic
1046297344 8:112237863-112237885 GGTGCTCCTGAAGAAGAACAGGG + Intronic
1046743014 8:117848331-117848353 TGTACTTCTGCCTAAGGAAATGG - Intronic
1049530837 8:143154059-143154081 TGAGCTCCTGACTCAGGACTGGG + Intergenic
1050209377 9:3236090-3236112 TATGTTCCTCACTAAGGATAGGG + Intronic
1051026956 9:12624383-12624405 TGAGCTCCTTACAAAGTACAAGG - Intergenic
1052422533 9:28261915-28261937 CTTGCTGGTGACTAAGGACAAGG + Intronic
1052941084 9:34132719-34132741 TGAGCTCCTGACCTAGGCCAAGG - Intergenic
1056757436 9:89390653-89390675 TGAGCTCCTGGCCAGGGACATGG + Intronic
1059962473 9:119578787-119578809 TGAGGTCCTGACTTAGGACAGGG - Intergenic
1061579179 9:131526500-131526522 TCTGCTGCTGAGGAAGGACAAGG + Intronic
1187042994 X:15616742-15616764 TGTGGCCCTGACCAAGGGCAAGG + Intergenic
1187597949 X:20795864-20795886 TGTGTTCCTCCATAAGGACAAGG + Intergenic
1190170741 X:48109825-48109847 TCTGCCCGTGAGTAAGGACATGG - Intergenic
1190191061 X:48277726-48277748 TCTGTCCCTGAGTAAGGACATGG + Intergenic
1190655888 X:52611906-52611928 TCTGTTCCTGAGTAAGGCCATGG + Intergenic
1190657502 X:52624828-52624850 TCTGTCCCTGAGTAAGGACATGG - Intergenic
1194788413 X:98115952-98115974 TGTGCTCAGGATGAAGGACATGG - Intergenic
1196015336 X:110933941-110933963 GGTGCACCTGACTGAGGAAAGGG - Intergenic
1198401374 X:136271533-136271555 TGTACTCCAGACTTAGTACATGG - Intergenic