ID: 1124088050

View in Genome Browser
Species Human (GRCh38)
Location 15:26570398-26570420
Sequence GGAGGGCGAGGCCCGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 421}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124088050_1124088064 21 Left 1124088050 15:26570398-26570420 CCTCCTCGCGGGCCTCGCCCTCC 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1124088064 15:26570442-26570464 TTGGGCACATTTGGGAAACATGG 0: 1
1: 0
2: 0
3: 23
4: 220
1124088050_1124088059 2 Left 1124088050 15:26570398-26570420 CCTCCTCGCGGGCCTCGCCCTCC 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1124088059 15:26570423-26570445 GCTCTGGGCCTTGCGCGACTTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1124088050_1124088063 13 Left 1124088050 15:26570398-26570420 CCTCCTCGCGGGCCTCGCCCTCC 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1124088063 15:26570434-26570456 TGCGCGACTTGGGCACATTTGGG 0: 1
1: 0
2: 0
3: 3
4: 27
1124088050_1124088062 12 Left 1124088050 15:26570398-26570420 CCTCCTCGCGGGCCTCGCCCTCC 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1124088062 15:26570433-26570455 TTGCGCGACTTGGGCACATTTGG 0: 1
1: 0
2: 0
3: 1
4: 21
1124088050_1124088060 3 Left 1124088050 15:26570398-26570420 CCTCCTCGCGGGCCTCGCCCTCC 0: 1
1: 0
2: 3
3: 44
4: 421
Right 1124088060 15:26570424-26570446 CTCTGGGCCTTGCGCGACTTGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124088050 Original CRISPR GGAGGGCGAGGCCCGCGAGG AGG (reversed) Intronic
900100556 1:960397-960419 GGAGGGCGAGGCCTGGTGGGGGG + Intergenic
900137880 1:1126114-1126136 GGAGGGCAGGGGCCGCGGGGTGG + Intergenic
900164834 1:1240511-1240533 GGAGGCAGAGGCCAGGGAGGTGG + Intergenic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
901024147 1:6270224-6270246 GGAGGGAGATGGCTGCGAGGAGG - Intronic
902331723 1:15734205-15734227 TGAGGCGGAGGCCCGGGAGGAGG - Exonic
902509546 1:16958714-16958736 GAAGGGCGAGGCCAGCCTGGAGG + Exonic
902875561 1:19338734-19338756 GGAAAGCGAGGCCGGCGAGAAGG + Intergenic
902893070 1:19459051-19459073 GGAGGGTCAGGCCCGTGGGGTGG - Intronic
902896990 1:19485710-19485732 CGGGGGCGGGGCCTGCGAGGCGG + Intergenic
903239732 1:21974817-21974839 GGAGGGAGGGGCCCAGGAGGTGG - Intergenic
903243538 1:21999747-21999769 GGAGGGAGGGGCCCAGGAGGTGG - Intergenic
903377608 1:22876530-22876552 GCAGGGGGAGGCCGGCCAGGCGG - Intronic
903867815 1:26411429-26411451 GGAGGACGCGGCCCGGGCGGCGG + Exonic
904210976 1:28886998-28887020 GGAGGGGGAGGCCCGGGCAGAGG - Intergenic
904744673 1:32703220-32703242 GCAGGGCGCGGCCGGGGAGGAGG + Intronic
905309277 1:37038152-37038174 GGGGGACGAGGCCAGGGAGGGGG - Intergenic
905692809 1:39955408-39955430 GGAGGGCGAGGGGAGGGAGGAGG + Intronic
905731923 1:40303821-40303843 GCAGGGCGAGTCCGGCGAGCCGG - Exonic
906104687 1:43284800-43284822 GGAGGGCGTGGCCAGGGAGCAGG - Intronic
906480453 1:46196050-46196072 GGAGGATGAGGCCCGGGAGCAGG - Exonic
910029873 1:82706059-82706081 GAAGGGCGAAACCCGGGAGGTGG + Intergenic
910359040 1:86396209-86396231 GGAAGGCAAGGGACGCGAGGTGG + Exonic
911527551 1:99004780-99004802 GGAGGACGAGGCACGGGAGGCGG + Exonic
912315106 1:108661162-108661184 GGTTGGCGAGCCCCGCGGGGAGG - Exonic
914869060 1:151458636-151458658 GGCGGGAGGGGCCGGCGAGGGGG - Intronic
915559222 1:156676753-156676775 GGCGCGGGAGGCCCGCGGGGCGG + Exonic
916680968 1:167104801-167104823 GGAGGTAGAGGCCCAGGAGGAGG - Intronic
918282835 1:183023174-183023196 GGGGGGAGGGGCGCGCGAGGTGG - Intergenic
919891997 1:201982569-201982591 CGGGGGCGGGGCCCGCGCGGCGG + Intronic
919999934 1:202790014-202790036 GGAGTTCGAGACCAGCGAGGCGG + Intronic
921089479 1:211830154-211830176 GGCGGGCGCGGCCCGCGCGCCGG + Intronic
923022508 1:230175655-230175677 GGAGGGGGAGGACAGTGAGGAGG - Intronic
923109449 1:230879572-230879594 AGAGGGGGAGGCCGGCAAGGGGG - Intergenic
923665325 1:235993681-235993703 GGATCGCGACGGCCGCGAGGTGG - Exonic
924289651 1:242524506-242524528 GGAGGGCGAGGTGCGGGCGGGGG + Exonic
924646085 1:245878367-245878389 GGGGGGCGAGGTCCACGAGGAGG + Intronic
1062774743 10:135610-135632 AGATGGCGCGGCCCGCGCGGTGG + Intronic
1063907814 10:10798727-10798749 TGAGGGCGAGTCCGGAGAGGAGG - Intergenic
1064035239 10:11908956-11908978 GGAGGGCGAGGCCCTGGACATGG - Intergenic
1065099766 10:22321399-22321421 GGAGGAGGAGGCCCCGGAGGAGG + Exonic
1065099784 10:22321456-22321478 GGAGGCCGAGGCGCCGGAGGAGG + Exonic
1065367836 10:24952624-24952646 GGAGGGCGAAGGCTGCGTGGGGG + Intergenic
1065967340 10:30780756-30780778 GGCGGGTGAGCCCCGCGGGGAGG + Intergenic
1067083877 10:43228113-43228135 GGACAGTGAGGCCAGCGAGGTGG - Intronic
1067084371 10:43230060-43230082 GGCGCGCGGGGCCGGCGAGGGGG + Intronic
1067441260 10:46310275-46310297 GGAGGCTGAGGCCCAGGAGGAGG + Intronic
1067577910 10:47419540-47419562 GGAGGCTGAGGCCTGGGAGGAGG + Intergenic
1070145764 10:73772417-73772439 GGAGAGGGAGGCCGGCGGGGAGG + Exonic
1070428702 10:76315432-76315454 GCAGGGAGAGGCCCGGGAGCAGG - Intronic
1070800673 10:79243004-79243026 GGACGGCGAGGCTCGCGGGGCGG + Intronic
1071505673 10:86230085-86230107 GGAGGGCTAAGGCCGGGAGGAGG - Intronic
1072241128 10:93496552-93496574 GCAGGGCGCGGCCCGCAAGAAGG - Intergenic
1072611246 10:97018954-97018976 GGAGGCAGAGGCCGGGGAGGAGG - Intronic
1072656767 10:97335016-97335038 GGAGGCCGCGGCCCAGGAGGCGG - Intergenic
1073143867 10:101266535-101266557 TGAGGCCGAGGCCCGCCAGCTGG + Intergenic
1075169732 10:120102067-120102089 GGAGGGCGAGGGAGGGGAGGGGG + Intergenic
1075748282 10:124743408-124743430 GGCGGGGGAAGCCCGCGGGGAGG - Intronic
1075871462 10:125774707-125774729 GGTGGGCGAGTGCCGGGAGGAGG + Intronic
1076383723 10:130042587-130042609 GTAGAGTGATGCCCGCGAGGAGG - Intergenic
1076878820 10:133230326-133230348 GGCGGGCGAGGGCGGCGCGGGGG - Exonic
1077049844 11:561631-561653 GGAGGGTGGGGCCCGTGCGGAGG + Intronic
1077103719 11:833075-833097 GGGGGGCGAGGGGCGCGAGGGGG + Intronic
1077103727 11:833093-833115 GGGGGGCGAGGGGCGCGAGGGGG + Intronic
1077190105 11:1252463-1252485 GGAGGGCGAGGACAGCGGGGCGG - Exonic
1077544848 11:3164921-3164943 GGCGGGTGGGGCCCGCGAGTGGG - Intronic
1079503390 11:21127638-21127660 GGAGGGGGAGGACAGGGAGGAGG + Intronic
1081469848 11:43359337-43359359 GCGGCGCGCGGCCCGCGAGGTGG - Intronic
1082023403 11:47553184-47553206 GGAGGGGGAGCGCGGCGAGGGGG + Intronic
1083743505 11:64723067-64723089 GGAGGGAGAGAGGCGCGAGGCGG - Exonic
1083939618 11:65888598-65888620 AGAGGGGGAGGCCTGCGCGGAGG + Intergenic
1084014633 11:66371382-66371404 GGAGGGGGTGGCCTGGGAGGCGG - Intronic
1084310218 11:68312495-68312517 GGAGGGCGCGGCCGGTGCGGGGG + Intergenic
1084349489 11:68585235-68585257 GGAGGGTGAGGCCCCCATGGAGG + Intronic
1084586494 11:70065636-70065658 GGAGGGCCAGGCCAACTAGGGGG - Intergenic
1085295593 11:75429987-75430009 GCTGGGCGTGGCGCGCGAGGAGG - Exonic
1087516423 11:99168323-99168345 GGAGGCCGAGGCCGGGGGGGTGG + Intronic
1090194232 11:124800714-124800736 GAGGGGTGAGGCCCTCGAGGGGG + Intergenic
1091286676 11:134412066-134412088 GGAGGGCGCGGGCAGGGAGGCGG + Intergenic
1091586977 12:1822118-1822140 GGAAAGCCAGGCCCGCGGGGAGG + Intronic
1092177134 12:6417761-6417783 GGAGGGTGATGCCCCCGGGGAGG - Intergenic
1094753482 12:33439713-33439735 GGAAGGAGAGGCGCGCGAGGAGG + Exonic
1096178591 12:49538849-49538871 GGGCGGGGAGGCCCGCGGGGTGG + Intergenic
1096204131 12:49707191-49707213 GGGGGCCGAGGCCCCTGAGGGGG - Exonic
1096417273 12:51425044-51425066 GGAGCGGGAGGCGCGGGAGGCGG - Intronic
1096693545 12:53335287-53335309 GGAGGGGGAGGGGGGCGAGGGGG - Intronic
1096882384 12:54683604-54683626 GGAGGACGAGGCCTGAGAGGAGG - Intergenic
1096883967 12:54698697-54698719 GGAGGGAGAGGCCTGAGGGGTGG + Intergenic
1097246863 12:57611743-57611765 GGAGGGAGGGGACCGGGAGGAGG - Intronic
1097732955 12:63150725-63150747 GGAGGCCGAAGCCCTCGGGGAGG - Exonic
1097743793 12:63276928-63276950 GGAGGCCAAGGCCCTCAAGGGGG - Intergenic
1101253787 12:102958175-102958197 GAGGTGCGGGGCCCGCGAGGGGG - Exonic
1102454942 12:113065477-113065499 AGAGGGAGAGGGCTGCGAGGGGG - Intronic
1102459754 12:113093249-113093271 GAAGGGCGGGGCCCACTAGGAGG + Intronic
1103512603 12:121485537-121485559 TGAGGGCGAGGCCATCAAGGAGG - Intronic
1104030890 12:125065340-125065362 GGAGGGCGGGGCCTGGAAGGGGG + Intergenic
1104992818 12:132635646-132635668 GGAGGTGGAGGCCCATGAGGTGG - Intronic
1106027438 13:25968449-25968471 GGAGGCCGAGGCTCGGGAAGTGG - Intronic
1106517040 13:30464993-30465015 GGGGCGCGCGGCCCGCGCGGAGG - Intronic
1106517112 13:30465253-30465275 GGCGGGCGAGGGCGGCGCGGGGG - Intronic
1107548325 13:41454376-41454398 GGCGGGCGACGCTCGCGACGCGG + Intergenic
1108662617 13:52600376-52600398 GGAGGGAGAGGGGCGCGGGGCGG - Intergenic
1109622324 13:64925890-64925912 GCAGGGTGAGAACCGCGAGGCGG + Intergenic
1110855951 13:80296832-80296854 GGAGGGGGAGGAGCGGGAGGAGG + Intergenic
1113565181 13:111315569-111315591 GCAGGGCGGGGCCAGGGAGGAGG - Intergenic
1113655616 13:112066706-112066728 GGGGGAGGAGGCCCGGGAGGGGG - Intergenic
1113820534 13:113209514-113209536 GCGGGGCGGGGCGCGCGAGGAGG + Intronic
1114069828 14:19097895-19097917 GGAAGGCGCGGCCCGGGTGGGGG + Intergenic
1114092433 14:19302107-19302129 GGAAGGCGTGGCCCGGGTGGGGG - Intergenic
1114318324 14:21526282-21526304 GGAGGGGGAGGGGAGCGAGGAGG + Intronic
1115993330 14:39171487-39171509 GGAGGCCGAGGCACGGGGGGTGG + Intergenic
1117315226 14:54566367-54566389 GGAGGGGGAAGCCCCCGGGGAGG - Intergenic
1117368295 14:55052137-55052159 GGCGGGCGCGACCCGCTAGGAGG + Intronic
1119003936 14:70907645-70907667 GGAGGAGGAGACCCGAGAGGAGG - Exonic
1119753596 14:77098371-77098393 GGAGGGCTCGGTCCGGGAGGAGG + Intronic
1120780090 14:88479267-88479289 GGAGGACGAGGACTTCGAGGAGG - Exonic
1121882686 14:97514825-97514847 GGAGGGGCAGGCCTGCCAGGAGG + Intergenic
1122066090 14:99175299-99175321 GGCGGGCGAGGGCCTCAAGGCGG - Exonic
1122300134 14:100726832-100726854 GGGGGGCGGGGGCCGCGAGGGGG + Exonic
1122422139 14:101584270-101584292 GGAGGGCGGGGCCGACGGGGCGG + Intergenic
1122445162 14:101762193-101762215 GGAGGGCGCGGCCCGGGGAGGGG + Intronic
1122557977 14:102591905-102591927 GGAGGCCGGGGCCCCCGGGGTGG - Intergenic
1122635368 14:103127252-103127274 GGAGCGCGAGGACCGCCAGGCGG + Exonic
1122707186 14:103628925-103628947 GCAGGGCGCGGCTCGCGGGGTGG - Intronic
1122924657 14:104894075-104894097 GGAGGGCTGGGCCCGGGATGAGG - Intronic
1123221573 14:106862327-106862349 GGAGGGTGGGGCAGGCGAGGGGG - Intergenic
1123630614 15:22257822-22257844 GGAGGGGGAGGGACGCAAGGCGG - Intergenic
1124088050 15:26570398-26570420 GGAGGGCGAGGCCCGCGAGGAGG - Intronic
1124973702 15:34514615-34514637 GCAGGGCGAGGGCAGAGAGGGGG - Intergenic
1128262566 15:66242740-66242762 GGTGGGAGAGGACCTCGAGGTGG - Intronic
1128269222 15:66293862-66293884 GGGGGGTGAGGCCGGCGAGCGGG - Intronic
1128327430 15:66734092-66734114 GGAGGGAGAGGCCGGAGAGGCGG + Intronic
1128570478 15:68729955-68729977 GGGGGGCGGGGGCCGGGAGGTGG - Intergenic
1129440567 15:75578572-75578594 GGTGAGGGAGGCCCGCGAGCCGG + Intronic
1129483229 15:75843875-75843897 GCAGGGCGAGGACGGAGAGGGGG + Intronic
1129814640 15:78540747-78540769 GGACGCCGGGGCCCGCGAGGGGG + Intronic
1129912958 15:79243413-79243435 GGAGAGGGAAGCCAGCGAGGAGG + Intergenic
1130270769 15:82445780-82445802 GCAGGGCGAGGGCGGAGAGGAGG + Intergenic
1130463111 15:84173103-84173125 GCAGGGCGAGGGCGGAGAGGAGG + Intronic
1130489563 15:84421685-84421707 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1130501154 15:84500447-84500469 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1131224577 15:90613094-90613116 GGAGGCTGAGGCCCAGGAGGTGG + Intronic
1131228239 15:90642610-90642632 AGAGGGCGAGGCCCTCCAGCGGG + Exonic
1132256700 15:100382724-100382746 GAAGGGCCAGGCCCGTGAGTAGG - Intergenic
1132321751 15:100930514-100930536 GGTGGGGGAGGCCAGGGAGGGGG - Intronic
1133048071 16:3100180-3100202 GGAGAGCGAGGCGCGGGACGCGG - Intergenic
1133230193 16:4362697-4362719 GGAGGGCGAGGTCAGCGAACTGG + Exonic
1133286743 16:4694245-4694267 GGGGGGCGGGGCCCGGGCGGCGG - Intronic
1133328684 16:4958059-4958081 GGAGGGCGGGGCCAGTGAAGGGG + Intronic
1136372711 16:29846191-29846213 GGAGGCCGAGTCCCGTGCGGAGG + Exonic
1137426315 16:48384669-48384691 GGAGGCCGAGGCCCGCCGAGCGG + Intronic
1138179160 16:54930730-54930752 AGAGGGCGAGGCGCGCCTGGCGG + Intergenic
1138595091 16:58025619-58025641 GGCGGCCGAGGCCCGACAGGTGG - Exonic
1139739040 16:69018821-69018843 GGAGGTTGAGGCCCGGGAGGCGG + Intronic
1140205308 16:72928186-72928208 GGAGGGGGAGGGGAGCGAGGGGG + Intronic
1140472964 16:75225246-75225268 GGAGGGCGTGGGCAGCGTGGGGG + Intergenic
1141972472 16:87492812-87492834 GGAGGGGGAGGGACGCGCGGCGG + Intergenic
1142050006 16:87951787-87951809 GGAGCGCGAGGCCCCCGGGCCGG - Intronic
1142163329 16:88570614-88570636 GGAGGAGGAGGCCGCCGAGGCGG + Intronic
1142343063 16:89536626-89536648 GGCGGGTGAGGCGGGCGAGGTGG + Intronic
1142343068 16:89536644-89536666 GGTGGGCGAGGCAGGCGAGGCGG + Intronic
1142367295 16:89657164-89657186 GGGGGTCGAGGCCCGGGAGAAGG + Intronic
1142395270 16:89828367-89828389 GGAGGGGGAGGGACGCGGGGCGG - Intronic
1142627753 17:1203325-1203347 GGGGGGCGGGGTCCGCGGGGAGG + Intronic
1142656757 17:1399750-1399772 GGAGGGCGAGTCCCGGGGCGGGG - Intronic
1142747568 17:1967531-1967553 AGAGGGAGAGGCCAGGGAGGAGG - Intronic
1142903257 17:3026431-3026453 GGAGGGCGAGGCCATGGAGGAGG + Exonic
1143148243 17:4790122-4790144 GGAAGGCGAGGAAGGCGAGGCGG - Exonic
1143273664 17:5694102-5694124 GGAAGGCGAGGCCGGCAAGCCGG - Intergenic
1143631178 17:8141181-8141203 TGAGGGAGAGGGCTGCGAGGAGG - Exonic
1144701410 17:17343377-17343399 GGTGGGCGTGGCAAGCGAGGTGG + Intronic
1144953022 17:19004204-19004226 GGAGGGCGGGCCGCGCGGGGAGG + Intronic
1146519349 17:33514400-33514422 GGAAGGCAAGGACCGCGATGAGG - Intronic
1147110467 17:38257437-38257459 CGAGGGCGCGGCCGGCGGGGCGG + Intergenic
1147424826 17:40341564-40341586 GGCGGGCGAGCCCCGCGGGCGGG + Intronic
1148339152 17:46863133-46863155 GGAGGGCGTGGCTCTGGAGGAGG - Intronic
1148419040 17:47530994-47531016 CGAGGGCGCGGCCGGCGGGGCGG - Intronic
1148742748 17:49902040-49902062 GGCGGGCGTGGCCCGCGGGGCGG + Intergenic
1148840871 17:50496060-50496082 GGAGGCCGAGGCAGGCGAGACGG - Intergenic
1148878625 17:50707865-50707887 GGGAGGCGCGGCCCGGGAGGAGG - Exonic
1149486453 17:57046381-57046403 GGAGGGGGAGGACGACGAGGAGG - Intergenic
1149865676 17:60149868-60149890 GGAGGGCAGGCCCCGCCAGGGGG + Intergenic
1150643700 17:66965508-66965530 GGAGGTGGAGGCTGGCGAGGGGG + Intronic
1152300517 17:79492869-79492891 GGAGAGAAAGGCCCGTGAGGAGG + Intronic
1152362490 17:79839132-79839154 GGCCGGAGCGGCCCGCGAGGAGG - Intronic
1152567507 17:81106825-81106847 GGCGGGGAAGGCCCGGGAGGCGG - Exonic
1152686362 17:81695618-81695640 GGAAGGCGAGGCCCTGGAGGCGG - Intronic
1152690466 17:81715608-81715630 GGAGGGGGAGGGGCGCGGGGTGG + Intronic
1152704276 17:81834701-81834723 GGTGGGAGAGGCCAGCAAGGAGG - Intronic
1152723596 17:81934655-81934677 GGAGGGCCTGGGCCCCGAGGCGG + Exonic
1152811531 17:82384969-82384991 GGAGGGTCAGCCCCGGGAGGTGG + Intergenic
1153474968 18:5489117-5489139 GGAGGCCGAGCCCCAGGAGGCGG - Exonic
1153904701 18:9650763-9650785 GGAGGCCGAGGTAGGCGAGGTGG + Intergenic
1154246339 18:12702827-12702849 GGGGTGCGGGGCCCGCGGGGAGG - Exonic
1157610101 18:48950608-48950630 GGAGGCCGGGGCGCGCGCGGGGG + Exonic
1158435935 18:57435645-57435667 GGCGGGCAAGGCGCGCGTGGCGG - Intergenic
1158890529 18:61867674-61867696 GGATGGTGAGGCCGGCGATGTGG - Intronic
1160454671 18:78992351-78992373 GGAGGGCGAGGCCAGGCCGGTGG + Exonic
1160703582 19:519006-519028 GGACGGCCAAGCCCCCGAGGAGG + Exonic
1160781612 19:880002-880024 GGACGGCGGGGCCCGCGGTGCGG + Exonic
1160812969 19:1020908-1020930 GGGGTGCGAGGCCCGCGCGCGGG + Exonic
1160859384 19:1231192-1231214 GGAGGGGGATGCCCCCCAGGAGG - Exonic
1161171543 19:2814705-2814727 GGAGGGTTATGCCAGCGAGGCGG + Exonic
1161172526 19:2820135-2820157 GGAGGTCGCGGCGCGGGAGGCGG - Intronic
1162832965 19:13298638-13298660 CGAGGGCGAGGGCCCCGACGGGG - Exonic
1163114570 19:15181200-15181222 GGAGGGCAGGGCCTGTGAGGGGG - Intronic
1163442401 19:17328620-17328642 GGAGGACGAGGACGACGAGGAGG - Exonic
1163696218 19:18764837-18764859 GGAGGGCAAGATCCACGAGGTGG + Intronic
1164624115 19:29715252-29715274 GGAGGGCGGGGCCAGCGCCGGGG - Intronic
1165079249 19:33298344-33298366 GGAGGGCGAGGCCCCCGGGGGGG - Intergenic
1165394131 19:35555102-35555124 GGAGGGAGAGGGCTGTGAGGAGG - Intronic
1165706599 19:37980601-37980623 GGAGGCTGAGGCCAGGGAGGAGG + Intronic
1165743639 19:38217722-38217744 GGAGGGAGAGGGCCACGAGGTGG + Intronic
1165787945 19:38473565-38473587 CGAGGACGAGGCCCGGGCGGCGG + Exonic
1166836173 19:45669286-45669308 GGAGGGAGAGGCACGCGGAGTGG - Intronic
1166871940 19:45876595-45876617 AGAGGGCCTGGCCTGCGAGGTGG - Intergenic
1167056031 19:47112196-47112218 AGCGGGCGAGCGCCGCGAGGGGG + Intronic
1167090692 19:47341621-47341643 CGAGGGCAAGGCCCACGATGAGG - Exonic
1167091739 19:47349087-47349109 AGAGGGCGGGGCCGGGGAGGAGG + Intergenic
1167341937 19:48921542-48921564 GGAGGGAAAGGCCCAGGAGGGGG + Intronic
1167490769 19:49791824-49791846 GGTGTGCGAGGCCAGCGAGAGGG - Intronic
1167903358 19:52638389-52638411 TCTGGGCGGGGCCCGCGAGGTGG + Intronic
1168104699 19:54159605-54159627 CGAGGCCCAGGCCCGGGAGGAGG - Exonic
1168154517 19:54465338-54465360 GGAGCGCGGGGCCCCCGCGGGGG + Exonic
1168536061 19:57171994-57172016 GGGGGCCGCGGGCCGCGAGGGGG + Intergenic
1168536072 19:57172012-57172034 GGGGGGCGGGGGCCGCGAGGGGG + Intergenic
1168536103 19:57172082-57172104 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536110 19:57172099-57172121 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536117 19:57172116-57172138 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536124 19:57172133-57172155 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536131 19:57172150-57172172 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536138 19:57172167-57172189 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536145 19:57172184-57172206 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536152 19:57172201-57172223 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168645896 19:58059310-58059332 GGTGAGCTAGGCCGGCGAGGAGG + Exonic
925971795 2:9111274-9111296 TGAGGGCCAGGCCCCCGGGGTGG - Intergenic
926150866 2:10424994-10425016 GGAGGGCAGGGCAGGCGAGGGGG - Intronic
926878584 2:17514521-17514543 GGAGGCCGAGGGCGGCGGGGGGG + Intronic
927938035 2:27086331-27086353 GGTGGGCGGCGCCCGCGCGGGGG - Exonic
927939959 2:27097393-27097415 GGAGGGAGAGGGCCTCGGGGAGG - Intronic
928094112 2:28393554-28393576 GGAGGGCGAGGACAGGGAGGCGG - Exonic
929847232 2:45542301-45542323 GCAGGGAGAGGCCAGGGAGGTGG + Intronic
929863274 2:45697249-45697271 GGAGGGCCAGGCCAGCCAGTGGG - Intronic
931587248 2:63841648-63841670 GGCGGGCGAGGCCGGCCAGCGGG - Intronic
931684966 2:64785001-64785023 GGAGGGCGTGGCGCACGAGCAGG + Intergenic
931754774 2:65362935-65362957 GGAGGCCGAGGCGGGCGAGCAGG + Intronic
932148191 2:69343331-69343353 GCAGGATGAGGCCCACGAGGAGG - Intronic
934079020 2:88452173-88452195 GGCGGGCGAGGCGGGCGCGGCGG + Exonic
934620045 2:95798263-95798285 GGGGGCCGAGGCCTGCAAGGAGG - Intergenic
934640843 2:96026294-96026316 GGGGGCCGAGGCCTGCAAGGAGG + Exonic
937993163 2:127675189-127675211 GCAGGGTGGGGCCCGCGGGGCGG + Intronic
938260451 2:129892053-129892075 GGAGGGCCAGGCTGGCGGGGAGG - Intergenic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
943342110 2:186694017-186694039 GGAGGAAGAGGCCCGGGAGGCGG - Exonic
946242954 2:218367934-218367956 GGAGGGAGACGCCCGCTCGGGGG + Exonic
946400196 2:219464580-219464602 GCAGTGCGAGGCCCGCTTGGAGG + Exonic
946412696 2:219522946-219522968 GGGCGGCGAGGCGCGCGAGCCGG + Intronic
947399119 2:229714582-229714604 GGCGGGCGGGGCCTGCGGGGCGG + Intergenic
947418324 2:229921205-229921227 GGAGGGCGAGCCCGGAGACGGGG - Intronic
947621007 2:231591089-231591111 GGAGGCTGAGGCCCAGGAGGAGG - Intergenic
948415383 2:237799018-237799040 TGTAGGCGAGGCCAGCGAGGCGG + Intronic
1168886924 20:1266485-1266507 GGGGGCCGCGGGCCGCGAGGAGG + Intronic
1171346341 20:24469276-24469298 GGAGGGCGCAGCCCGCGCGAAGG - Exonic
1171459986 20:25292804-25292826 TGCGGGCGAGGCCCACGTGGGGG + Intronic
1172284689 20:33732257-33732279 GGAGAGCCAGGCCGGCGGGGAGG + Intronic
1172603263 20:36197989-36198011 GGAGGGGGAGGCGGGGGAGGAGG - Exonic
1172772135 20:37388062-37388084 GGAGGGAGAGGCCCGTGCAGGGG + Intronic
1173704178 20:45098021-45098043 CGAGTACCAGGCCCGCGAGGCGG - Exonic
1173791989 20:45833937-45833959 GGAGGTAGAGGCGCACGAGGCGG + Exonic
1173809120 20:45945712-45945734 GGAGGTGGAGGCCCCTGAGGTGG + Exonic
1173861600 20:46287489-46287511 CGAGGGCGAGGGCAGCCAGGTGG + Intronic
1174317477 20:49713793-49713815 GGCCCGCGAGGCCCGGGAGGCGG - Exonic
1174701862 20:52617231-52617253 GAAGGGAGAGGCCGGGGAGGGGG + Intergenic
1176101136 20:63365098-63365120 GGAGGGGGAGGCCCTTGGGGGGG - Intronic
1176115227 20:63429252-63429274 GGTGGGGGAGGCCCCAGAGGAGG - Intronic
1176150854 20:63590060-63590082 GGAGGGCGAGGCCCCTGGGACGG - Exonic
1176213706 20:63938637-63938659 GGGGGGCGGGGCCAGCGCGGGGG + Intergenic
1176383517 21:6125741-6125763 GGTGGGAGAGGCCGGGGAGGGGG + Intergenic
1176549949 21:8216863-8216885 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1176568875 21:8399897-8399919 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1176576789 21:8444132-8444154 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1178680567 21:34669739-34669761 GCAGGGCGAGCCCCGCGGGGAGG + Exonic
1179416024 21:41199350-41199372 GGAGGGGAAGGCTGGCGAGGAGG + Intronic
1179739953 21:43412497-43412519 GGTGGGAGAGGCCGGGGAGGGGG - Intergenic
1180488295 22:15820459-15820481 GGAAGGCGTGGCCCGGGTGGGGG + Intergenic
1180599783 22:17008264-17008286 GGAGGGCGAGACCCGGGCGCAGG + Intergenic
1180615053 22:17121181-17121203 GGCGGGCGAGGCGGGCTAGGCGG + Exonic
1180743074 22:18067275-18067297 GGATGGCGAGGCTGGAGAGGGGG - Intergenic
1180782398 22:18528595-18528617 GCAAGGGGAGGCGCGCGAGGCGG + Exonic
1181029127 22:20141549-20141571 GGGGGACGAGGCCTGCCAGGGGG - Intronic
1181239287 22:21467930-21467952 GCAAGGGGAGGCGCGCGAGGCGG + Intergenic
1181539638 22:23566415-23566437 GGAGGGAGAGGCCCGAGCAGGGG + Intergenic
1181811393 22:25405547-25405569 GCAGGGCGAGGAGCGCGGGGAGG - Intergenic
1181934480 22:26429194-26429216 GGGGGGCGGGGCCTGCGGGGCGG - Intergenic
1182036548 22:27202975-27202997 GGAGGGGGAGGGCCGCGGGCTGG - Intergenic
1182472151 22:30555231-30555253 GGAGCGCATGGCCCGCGAGGTGG - Exonic
1182603983 22:31489533-31489555 GGGGCGCGAGGCCCGCAAGGCGG - Exonic
1182704972 22:32271284-32271306 ACAGGGCGAGGCCCGCAGGGAGG + Intergenic
1183095861 22:35551990-35552012 GGAAGGCCAGGCCCGTGAGAGGG + Exonic
1183649512 22:39145842-39145864 GCAGGGCGAGCCCTGCGCGGCGG - Intronic
1183899441 22:40993919-40993941 GGAGGGAGAGGCCAGACAGGAGG + Intergenic
1184131630 22:42519883-42519905 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184141848 22:42582098-42582120 GGCGGGCGGGGCCGGGGAGGCGG - Intergenic
1184241776 22:43214713-43214735 GGAGGGCCTGGCGGGCGAGGTGG + Intronic
1184412080 22:44331451-44331473 GCAGGGCGGGGGCCGCGCGGGGG - Intergenic
1184470299 22:44692253-44692275 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184470321 22:44692312-44692334 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184470426 22:44692574-44692596 GGAGGAGGAGCCCCGGGAGGAGG - Intronic
1184740500 22:46426132-46426154 GGAGGGCGCAGCCGGGGAGGGGG + Intronic
1203254839 22_KI270733v1_random:133189-133211 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1203262895 22_KI270733v1_random:178268-178290 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
949938537 3:9136151-9136173 CGTGGGCCAGGCCTGCGAGGAGG - Intronic
950363895 3:12469459-12469481 GGAGGGAGAGGCCAGGCAGGTGG - Intergenic
950374306 3:12557373-12557395 GCTGGGCGAGGCCAGCGCGGGGG + Intronic
950548685 3:13653831-13653853 GGAGGCAGAGGCCTCCGAGGAGG - Intergenic
950668231 3:14509984-14510006 TGAGGAGGAGGCCCCCGAGGGGG + Intronic
951217669 3:20040326-20040348 GGAGGGCGGGGGCGGGGAGGGGG + Exonic
952816487 3:37452081-37452103 GGAGGGGCGCGCCCGCGAGGTGG - Intergenic
954337681 3:49929379-49929401 GGAGGGCGAGATCCGGTAGGGGG - Intronic
955930352 3:64050033-64050055 GGAGGGAGCAGCCCGGGAGGTGG + Intergenic
958980084 3:100709885-100709907 GGAGGACGAGGCCGGGGGGGAGG + Intronic
961653383 3:128428643-128428665 GGACCCCGAGGCCCGCCAGGTGG + Intergenic
961660726 3:128467623-128467645 GGAGGGCCAGGACGGGGAGGCGG - Intergenic
962318779 3:134374608-134374630 GGAAGGCGGGGGCCGGGAGGAGG - Intronic
962722258 3:138187223-138187245 GGTGGGCGGGGCCCCAGAGGCGG - Intergenic
963905603 3:150771281-150771303 GGAGGGAGAGGCTGGTGAGGTGG - Intergenic
965590606 3:170357559-170357581 GGAGAGCGAGGGCGGCGGGGAGG - Intergenic
966182326 3:177197920-177197942 GGGCGGGGAGGCCCGCGCGGTGG + Intergenic
968225608 3:196970100-196970122 GGAGTGCGAGGCCGGCGGGGAGG - Intergenic
968258386 3:197298673-197298695 GGAGGGCGGGGCCTGGGAGAGGG + Intronic
968585909 4:1416032-1416054 TGGGGACGAGGCCAGCGAGGCGG - Intergenic
968597943 4:1495025-1495047 GGAGGGCTGGGCCCGCGTGAGGG - Intergenic
968601894 4:1513418-1513440 GGAGGGCGGGGACCTCCAGGCGG - Intergenic
968642532 4:1721710-1721732 GGAGGGCGAGGGCCGAGGGCGGG - Intronic
968735958 4:2296710-2296732 GGGAGGGGAGGCCCGCGGGGCGG + Intronic
968909626 4:3471025-3471047 GGAAGCTGAGGCCCTCGAGGTGG + Intronic
970008046 4:11428931-11428953 GGAGGGGGAGGAGCGGGAGGAGG + Exonic
971196060 4:24472279-24472301 GGAGGCAGAGGCTCGGGAGGGGG - Intergenic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
973230971 4:47838113-47838135 GGAGGGTGTGGCCCGCGGGTGGG - Intergenic
973613824 4:52659764-52659786 GGCTGCCGAGGCCCGCCAGGAGG - Intergenic
973954571 4:56049604-56049626 GGATGGCGAGGCGCGGGAAGAGG - Intergenic
977210039 4:94208016-94208038 CGGGCGCGAGGCCCGCTAGGGGG + Intronic
980137418 4:128872016-128872038 GCAGGGAGAGGCCCACGATGGGG + Exonic
981203234 4:142008610-142008632 GGAGGGTGAGGGCTGGGAGGTGG - Intergenic
981315655 4:143337280-143337302 GGACGCCGAGGCCCGCGGAGTGG - Intronic
984892256 4:184504490-184504512 GCCGGGAGAGGCCTGCGAGGTGG + Intergenic
985064229 4:186105267-186105289 GGCGGGCGACCGCCGCGAGGCGG - Intronic
985141006 4:186840607-186840629 GGAGGGAGAGGAGCGGGAGGGGG - Intergenic
985660855 5:1155908-1155930 GGAGGGCGGGGCCGGCGGGGCGG + Intergenic
985990315 5:3552378-3552400 GGAGGGCGGGGCCTGAGAGGAGG + Intergenic
986320973 5:6632811-6632833 GGACCCCGAGGCCTGCGAGGCGG - Intronic
987089979 5:14501827-14501849 GGAGGGCCAGGCTCCCGTGGAGG + Intronic
989229969 5:39074437-39074459 GGCGGGCGCGGCGCGCGGGGAGG - Intergenic
989294018 5:39802836-39802858 GGAGGCCAAGGCGGGCGAGGAGG + Intergenic
989425496 5:41291080-41291102 GGAGGGAGAGGCCAGGGAGTGGG + Intergenic
990218476 5:53560945-53560967 TGAGTGCGAGGCCGGGGAGGAGG + Intronic
992105513 5:73447184-73447206 CGAGGGCGAGGCCTGAGCGGCGG + Exonic
992202653 5:74399452-74399474 GGAGGGCAAGGCCCAAGATGAGG + Intergenic
994043349 5:95283755-95283777 GGGGGGCGGGGGCCGGGAGGCGG - Intronic
995975846 5:118034059-118034081 GGGGGGCGAGGAGGGCGAGGCGG - Intergenic
997445262 5:133935652-133935674 GGAGGGCGAGGGGCCTGAGGTGG - Intergenic
997462998 5:134067666-134067688 GGAGGGCGAGGGAGGAGAGGGGG + Intergenic
998583507 5:143403838-143403860 GGGTGGCGGGGCCCGCGCGGAGG - Intronic
1001600757 5:172926627-172926649 GGAGGGGGAGGGCAGAGAGGTGG + Intronic
1002455429 5:179343664-179343686 GGAGGGCAAGGCCTGCGCTGAGG - Intronic
1002526087 5:179816890-179816912 GGAGGGAGAGGCTGGCGAGGGGG + Intronic
1002559471 5:180071764-180071786 GGCGGGCGCGGCCCGGGCGGCGG + Exonic
1005040385 6:21595346-21595368 GGAGGCCGAGGCTGCCGAGGAGG - Exonic
1005040478 6:21595703-21595725 GGAGGACGAGGAGCCCGAGGAGG - Exonic
1007626225 6:43247731-43247753 GGAGGGTGAGGCCCGGGTGCAGG + Intronic
1008378672 6:50819830-50819852 GGCGGCCGAGGCGGGCGAGGTGG + Intronic
1008378679 6:50819848-50819870 GGTGGGAGAGGCGGGCGAGGTGG + Intronic
1010794793 6:80106620-80106642 GGAGGGCGGAGCACCCGAGGAGG - Intergenic
1011410172 6:87059623-87059645 GGCGGGGGAGGCCAGGGAGGTGG + Intergenic
1012912779 6:105136761-105136783 CGAGGGCGCGGCCAGCGAGGAGG + Intronic
1013575915 6:111483340-111483362 GGAGGGCGGGGGCCGAGAAGGGG + Intronic
1014137655 6:117907611-117907633 GGCGGCCGCGGCCCGGGAGGCGG - Exonic
1015525824 6:134175033-134175055 AGAGGGCGAGCCCCGGGCGGGGG + Intronic
1016597074 6:145814785-145814807 GCGGGGCGGGGCGCGCGAGGAGG - Intergenic
1017891759 6:158644824-158644846 GAAGGGCGGGGCCCGGGAGCTGG - Intergenic
1018013599 6:159693334-159693356 GCGGGGCGGGGCCCGCGGGGGGG - Intronic
1019392067 7:794154-794176 AGAGGGTGAGGCCTGCGTGGAGG - Intergenic
1019525731 7:1479618-1479640 GCAGGGCGAGGGCCACGGGGCGG + Exonic
1019711535 7:2520236-2520258 GCAGGTCGAGGCGCGCGCGGTGG - Exonic
1020083099 7:5296825-5296847 GGAGGGCGGGGCCGGTGGGGAGG + Intronic
1020204433 7:6104452-6104474 AGAGGGCGAAGCCCACGAAGCGG + Intergenic
1021476606 7:21068761-21068783 GTAGGGTGAGGCCCACGTGGGGG - Intergenic
1021881381 7:25098247-25098269 GGAGGCTGAGGCCCGGGAGGTGG + Intergenic
1021969388 7:25951441-25951463 GGAGGGCGGGGCGCTCCAGGTGG + Intergenic
1023848710 7:44138895-44138917 GCAGGGCCAGGCCCACGGGGGGG - Exonic
1024599018 7:50963300-50963322 GGAGGGGGAGGGCCAAGAGGAGG - Intergenic
1025211204 7:57020405-57020427 GGAGGGCGGGGCCGGCGGGGAGG - Intergenic
1025660751 7:63556442-63556464 GGAGGGCGGGGCCGGCGGGGAGG + Intergenic
1026909632 7:74084351-74084373 CCAGGGCGAGGCCCGGGTGGTGG - Intronic
1027222182 7:76221016-76221038 GCAGGGAGAGGCCTGGGAGGAGG - Intronic
1028136679 7:87230266-87230288 GGAGGGCGAGGCCAGGCAGCAGG - Intergenic
1029123026 7:98281291-98281313 GGAGGGCGGGGCCTGAGAGGGGG - Intronic
1029226746 7:99034113-99034135 GGAGGGTGTGGCCTGTGAGGGGG - Intronic
1029445848 7:100612533-100612555 GGTGGGCGTGGCCGTCGAGGTGG + Exonic
1029715089 7:102321392-102321414 GGAGGGCGAGGCAGGCGGGCAGG - Exonic
1031243009 7:119270288-119270310 GGAGGGCAAGGCCCACGATGAGG + Intergenic
1032014533 7:128369594-128369616 GGAGGCCGAGGCCGGAGCGGGGG + Intergenic
1032545495 7:132738244-132738266 GGAGGGCGAGGCAGGGGTGGTGG + Intergenic
1034263885 7:149772467-149772489 GGAGGGCAGGGCCCGCGGGAAGG - Intronic
1034430303 7:151037954-151037976 GGAGGGCGAGGCTGCCAAGGAGG - Intronic
1034528958 7:151683685-151683707 GGATGGCGAGCGCCGTGAGGGGG + Intronic
1035021724 7:155804516-155804538 GGAGGGGGAGGCCCGCGAGCTGG - Intronic
1036749747 8:11436271-11436293 GGAGGGCCAGGCCCGCCACTAGG + Intronic
1036757938 8:11483729-11483751 GGAGGGCTTGGGCCGTGAGGTGG + Intergenic
1036786651 8:11692579-11692601 GGAGGGCGTGGCCCCCGCGCTGG + Intronic
1036906811 8:12714007-12714029 GGCGGGCGACCCCCGCGATGCGG - Intergenic
1037989982 8:23314952-23314974 GGAGGGGGTGGCCAGCGAGGAGG + Intronic
1041708197 8:60868765-60868787 GGAGGCTGAGGCCCGGGAGTTGG + Intergenic
1044819328 8:96145180-96145202 GGAGGCCGAGGCGCGCGCGCGGG - Exonic
1045489190 8:102656090-102656112 GGAGGGCCAGCCCCACGTGGGGG + Intergenic
1047321208 8:123785420-123785442 GGAGGGCAAGGCCAGAGAGTTGG + Intronic
1048214083 8:132480304-132480326 GGAGGGCGGCGGCCGCGACGAGG - Exonic
1048862338 8:138733114-138733136 GGAGGGCTTGGCCCGAGAAGAGG - Intronic
1049308030 8:141917744-141917766 GGAGGCTGAGGCCCGGGAAGCGG + Intergenic
1049396433 8:142403143-142403165 GGCGGGCGAGGCGGGCGGGGCGG + Exonic
1049411432 8:142475571-142475593 GGAGGGCGGCGGCTGCGAGGGGG + Exonic
1049513091 8:143039579-143039601 GGAGGGGGCGGCCTGCGGGGAGG + Intronic
1049614214 8:143569171-143569193 GGCGGGCGGGGCCTGGGAGGCGG + Intronic
1049665659 8:143841412-143841434 GCAGGGCGGGGCCTCCGAGGGGG - Intergenic
1049698308 8:143994371-143994393 GGAGGGCGGGGCAGGCGAGGAGG - Intronic
1049774252 8:144397293-144397315 ACAGGGCGAGGCCCGCAGGGAGG - Exonic
1049803430 8:144528601-144528623 GGTGGGCGGGGCCTGCGCGGTGG - Intronic
1051278905 9:15422420-15422442 GGAGGGCGAGGGCCGAGACCAGG - Intergenic
1051344482 9:16139952-16139974 GGAGGGGGAGGACGGGGAGGAGG - Intergenic
1053323494 9:37120716-37120738 AGACGTCGAGGCCGGCGAGGGGG - Exonic
1053435169 9:38069309-38069331 GGGGGGCGGGGCGCGCGAGCGGG - Intergenic
1056992361 9:91423759-91423781 CGAGGGCGCGGCGCGGGAGGCGG + Exonic
1057601889 9:96465374-96465396 GGACGTGGAGGCCCGAGAGGGGG + Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059191790 9:112333712-112333734 GGAGGGCGGGGACGGTGAGGGGG - Intergenic
1060069930 9:120537364-120537386 GGAGGGCAAGGGCAGGGAGGAGG - Intronic
1060312807 9:122477869-122477891 GGATGGGGAGGCCCAGGAGGAGG + Exonic
1060918126 9:127403265-127403287 GGAGGGTGGGGTCAGCGAGGAGG + Intronic
1060962672 9:127692145-127692167 GGAGGTCAAGGGCGGCGAGGGGG - Exonic
1061164221 9:128913131-128913153 GGAGGGCGAGGCCAGAGCGTGGG + Intronic
1061293519 9:129665560-129665582 GGCGGGCGAGGCGCGCGGGGAGG + Intergenic
1061327771 9:129874650-129874672 GCAGGTCGAGCCCCTCGAGGGGG - Exonic
1061497226 9:130981930-130981952 GGAGGGCGGGGGCCGCAGGGAGG - Intergenic
1061961532 9:133991525-133991547 AGAGGCGGAGGCCGGCGAGGGGG + Intronic
1061996021 9:134186470-134186492 GAAGGGTGAGGCCTGGGAGGGGG + Intergenic
1062092040 9:134683367-134683389 GGAGGGCCAGGCCAGGGAGCGGG + Intronic
1062093207 9:134689346-134689368 GGAGGGCCAGGCCAGAGAGCGGG + Intronic
1062094159 9:134694482-134694504 GGAGGGCGGTGCCCCTGAGGAGG - Intronic
1062431145 9:136527394-136527416 GGTGGGTGTGGGCCGCGAGGTGG + Intronic
1062483511 9:136763232-136763254 TGAGGGCGGGGCCTGTGAGGAGG + Intronic
1062518178 9:136946362-136946384 GCAGGGAGAGGGCCCCGAGGGGG + Intronic
1062533915 9:137013376-137013398 GGTGGGCCAGGCGGGCGAGGGGG - Intronic
1062651165 9:137578577-137578599 GGAGGGCGGGGCCGGCCACGAGG - Intronic
1203471240 Un_GL000220v1:116334-116356 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1203479061 Un_GL000220v1:160306-160328 GGCGGGGGAGGGCCGCGAGGGGG - Intergenic
1185747461 X:2584174-2584196 GGAGGGCGGGGGGCGCGCGGGGG + Intergenic
1185877584 X:3713196-3713218 GGAGAGCGACTCCCGCAAGGTGG - Exonic
1188535345 X:31190610-31190632 GGAGGGGGAGGGCGGGGAGGGGG + Intronic
1190388839 X:49911783-49911805 GGAGGTTGAGGCCGGCAAGGTGG + Intergenic
1192268392 X:69556063-69556085 AGAGGGAGAGGCCCGTGAAGGGG + Intergenic
1195269456 X:103215545-103215567 GGGGGGCGAGGGTGGCGAGGAGG + Intronic
1198100436 X:133417349-133417371 GGAGGGCGGGGGCGGCGGGGGGG - Intergenic
1198267404 X:135022228-135022250 GCAGGGCGGGCCCCGTGAGGCGG + Exonic
1200103209 X:153698628-153698650 GGAGGGCCAGGCCGGAGATGTGG - Intergenic
1202372084 Y:24205509-24205531 GCAGGGCGAGGGCGGAGAGGAGG - Intergenic
1202379826 Y:24266845-24266867 GGAGAGTGAGGGCCGCGAGTTGG - Intergenic
1202490956 Y:25403276-25403298 GGAGAGTGAGGGCCGCGAGTTGG + Intergenic
1202498701 Y:25464607-25464629 GCAGGGCGAGGGCGGAGAGGAGG + Intergenic