ID: 1124088951

View in Genome Browser
Species Human (GRCh38)
Location 15:26579496-26579518
Sequence TGGTTGTCATCACAGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 693}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124088942_1124088951 19 Left 1124088942 15:26579454-26579476 CCATGGGTCAGGAGCATTCAACC 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1124088951 15:26579496-26579518 TGGTTGTCATCACAGGACTGGGG 0: 1
1: 0
2: 3
3: 25
4: 693
1124088944_1124088951 -2 Left 1124088944 15:26579475-26579497 CCAACCCATTCACTGGCTTCATG 0: 1
1: 1
2: 0
3: 15
4: 199
Right 1124088951 15:26579496-26579518 TGGTTGTCATCACAGGACTGGGG 0: 1
1: 0
2: 3
3: 25
4: 693
1124088946_1124088951 -6 Left 1124088946 15:26579479-26579501 CCCATTCACTGGCTTCATGGTTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1124088951 15:26579496-26579518 TGGTTGTCATCACAGGACTGGGG 0: 1
1: 0
2: 3
3: 25
4: 693
1124088947_1124088951 -7 Left 1124088947 15:26579480-26579502 CCATTCACTGGCTTCATGGTTGT 0: 1
1: 0
2: 0
3: 24
4: 211
Right 1124088951 15:26579496-26579518 TGGTTGTCATCACAGGACTGGGG 0: 1
1: 0
2: 3
3: 25
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124088951 Original CRISPR TGGTTGTCATCACAGGACTG GGG Intronic