ID: 1124090210

View in Genome Browser
Species Human (GRCh38)
Location 15:26592289-26592311
Sequence TATTGGAGGCTGTAGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090210_1124090213 18 Left 1124090210 15:26592289-26592311 CCTAGAGGCTACAGCCTCCAATA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090210 Original CRISPR TATTGGAGGCTGTAGCCTCT AGG (reversed) Intronic
901267934 1:7926356-7926378 TATAGTAGGCTGTACCATCTAGG + Intronic
905043292 1:34977347-34977369 TGTTGGCGGCTGCAGCCTCTGGG - Intergenic
906567708 1:46812644-46812666 TACTGGAGGCTGTTGCCTGCTGG + Intronic
906594988 1:47068025-47068047 CATTAGAAGCTGTAGCATCTTGG - Intronic
908058624 1:60321848-60321870 TATTTGAGACCGTAGCATCTTGG + Intergenic
908690780 1:66777343-66777365 TATTGGAAGCAGATGCCTCTGGG + Exonic
908790857 1:67779820-67779842 TGTGGTAGGCTGTACCCTCTAGG - Intronic
908794267 1:67815956-67815978 TATTAGAGACTGTACCCTCTGGG + Intronic
913705657 1:121419544-121419566 TATTTGTTGCTGCAGCCTCTAGG + Intergenic
916710873 1:167406506-167406528 TACTGGAGGCTATAACCTCCAGG - Intronic
916813804 1:168330705-168330727 TGTAGTAGGCTATAGCCTCTAGG + Intergenic
916902147 1:169238351-169238373 TATTGGAGTCTATAGTCTCTGGG + Intronic
917016321 1:170534735-170534757 TATAGTAGGCTGTACCATCTAGG + Intronic
918170156 1:181988756-181988778 TACTGGAGGCAGTGTCCTCTGGG - Intergenic
918645691 1:186902038-186902060 TATAGCAGGCTGTACCATCTAGG - Intronic
919967557 1:202543496-202543518 TTTGGGAGGCTGAAGCCTCGTGG + Intronic
923489804 1:234474641-234474663 TACTGGAAGCTCTAGCTTCTGGG + Intronic
923807553 1:237274929-237274951 TATAGGAGGCTGTACCATTTAGG + Intronic
1063605458 10:7519553-7519575 TGTAGGAGGCTGTACCATCTAGG - Intergenic
1064179076 10:13099790-13099812 TAGTGGAGGCTGGAGCCGCAGGG - Intronic
1066352494 10:34649360-34649382 TGTAGGAGGCTCTACCCTCTAGG - Intronic
1067389784 10:45852777-45852799 TAATGCAGATTGTAGCCTCTAGG - Intronic
1067501683 10:46811073-46811095 TAATGCAGATTGTAGCCTCTAGG + Intergenic
1067592897 10:47528933-47528955 TAATGCAGATTGTAGCCTCTAGG - Intronic
1067640013 10:48037036-48037058 TAATGCAGATTGTAGCCTCTAGG - Intergenic
1068221760 10:54054176-54054198 TATTTGAGGCTGTAGCTTAAAGG + Intronic
1068546376 10:58350848-58350870 TATAGTAGGCTGTACCATCTAGG - Intronic
1069653746 10:70071641-70071663 TACAGGAGGCTGTACCATCTAGG - Intronic
1070136970 10:73702980-73703002 TAATGTAGATTGTAGCCTCTAGG - Intergenic
1071494622 10:86159522-86159544 TATAGGTGGCTGTACCCTCTAGG + Intronic
1072466162 10:95664220-95664242 CCTTGGAGGCTGTGGCTTCTGGG + Exonic
1074398142 10:113117317-113117339 TATTTCAGGTTGTAGCATCTAGG - Intronic
1079343149 11:19629653-19629675 TATTTGAGGGTCCAGCCTCTTGG - Intronic
1080285728 11:30608819-30608841 AATAGGAGACTTTAGCCTCTGGG + Intergenic
1082570637 11:54733922-54733944 GAGTGGAAGCTGTAGCCACTAGG + Intergenic
1083014231 11:59436309-59436331 GATTGGAGGCCCTAGCCACTGGG + Intergenic
1084288424 11:68146589-68146611 TTATGGAGGCTGGAGTCTCTGGG + Intergenic
1084710656 11:70841916-70841938 TTTGGGAGGCTGTGGGCTCTGGG - Intronic
1084748780 11:71190164-71190186 TAATGGCAGCTGTAGCCACTGGG - Intronic
1085944943 11:81258058-81258080 TATTGGAGGCTATACCATCTAGG + Intergenic
1086689719 11:89775460-89775482 ACTTGGAAGTTGTAGCCTCTGGG - Intergenic
1086716136 11:90064496-90064518 ACTTGGAAGTTGTAGCCTCTGGG + Intergenic
1087889132 11:103516998-103517020 TATGGTAGGCTGTATCATCTAGG - Intergenic
1091063626 11:132488361-132488383 TATAGTAGGCTGTACCATCTAGG - Intronic
1092804367 12:12206109-12206131 TATAGCAGGCTGTACCATCTAGG + Intronic
1094618012 12:32053679-32053701 TATAGTAGGCTGTATCATCTAGG + Intergenic
1097377886 12:58860370-58860392 GATTGGGGCCTGTAGCCCCTTGG - Intergenic
1098746231 12:74240633-74240655 TTTTGGAGACTTTAGACTCTGGG + Intergenic
1100035236 12:90242347-90242369 TAACGGAGGAAGTAGCCTCTGGG + Intergenic
1101045144 12:100797477-100797499 GAGCGGAGCCTGTAGCCTCTTGG + Intronic
1103459434 12:121092008-121092030 TTTGGGAGGCTGTTGCCTCCAGG - Intergenic
1104033962 12:125085657-125085679 TTATGGAGGATGTAGCCACTGGG + Intronic
1105506158 13:21011828-21011850 TGTAGGGGGCTGTAGCATCTAGG - Intronic
1106884587 13:34170702-34170724 TATGTGAGACTATAGCCTCTGGG - Intergenic
1108688147 13:52838671-52838693 GACTGGTGGTTGTAGCCTCTTGG + Intergenic
1108747118 13:53407236-53407258 TATGGTAGGCTATAGCATCTAGG - Intergenic
1110792604 13:79601914-79601936 TATTGGAAGGTGGGGCCTCTGGG + Intergenic
1119850897 14:77866117-77866139 TATTGTAGGCTGTCCCATCTAGG - Intronic
1119889944 14:78175008-78175030 TGTTGGAGGCTGCAGCCTGAAGG + Intergenic
1121042812 14:90762795-90762817 CATTGGAGCCCTTAGCCTCTTGG - Intronic
1121070896 14:91019928-91019950 TATAGTAGGCTGTACCATCTAGG - Intronic
1121188630 14:92001805-92001827 AATAGGAAGCTCTAGCCTCTAGG + Intronic
1124090210 15:26592289-26592311 TATTGGAGGCTGTAGCCTCTAGG - Intronic
1124608848 15:31193672-31193694 GGTTGGAGGCTGCAGCCTCAGGG + Intergenic
1125001271 15:34772758-34772780 GATCCAAGGCTGTAGCCTCTAGG - Intergenic
1127589001 15:60404441-60404463 TTTCGGCGGCTGTAGCGTCTGGG - Intergenic
1127719776 15:61688256-61688278 ACTTGGAGGATGTAGCTTCTGGG + Intergenic
1128591029 15:68897444-68897466 TATTTCAGTCTGTAGCCTGTTGG - Intronic
1128775551 15:70317416-70317438 TAGTAGAGGCTGGAGCCCCTTGG + Intergenic
1129490524 15:75921023-75921045 TATAGTAGGCTGTAACATCTAGG - Intronic
1129603988 15:77015905-77015927 TCCTGGAGCCTGCAGCCTCTGGG + Intronic
1131364923 15:91830799-91830821 TGTGGGAGGCTGTACCATCTAGG + Intergenic
1132362008 15:101224118-101224140 TGTTGGAGGCTGTACCATCTAGG + Intronic
1133158781 16:3895089-3895111 TATGGTAGGCTGTACCGTCTAGG + Intergenic
1134237043 16:12474706-12474728 CATTGGAGGCTTTACCCTGTGGG + Intronic
1135916230 16:26607915-26607937 TAATGGAGGCTGTAGTATGTAGG - Intergenic
1135994089 16:27235414-27235436 GGGTGGAGGCTGCAGCCTCTTGG + Intronic
1138029345 16:53547465-53547487 TACTAGAGGCTGGAGTCTCTTGG - Intergenic
1140320223 16:73943454-73943476 TATAGTAGGCTGTACCATCTAGG - Intergenic
1144504278 17:15817063-15817085 TATTGGAGGTTGTACCCAGTAGG - Intergenic
1144634032 17:16892730-16892752 TATTGGAGGTTGTACCCAGTAGG - Intergenic
1145168133 17:20632570-20632592 TATTGGAGGTTGTACCCAGTAGG - Intergenic
1146164221 17:30575541-30575563 TATTGGAGGTTGTACCCAGTAGG - Intergenic
1151456663 17:74230455-74230477 TAGTGGAAGCTGTGGGCTCTGGG + Intronic
1151494483 17:74451251-74451273 CACTGGAGACTGCAGCCTCTGGG - Intronic
1153728490 18:7981818-7981840 TATTGAATGCTGTAGACTCTTGG + Intronic
1154102515 18:11489325-11489347 TCTTGGAGCCTGTTACCTCTGGG - Intergenic
1159422604 18:68242752-68242774 TATTGGAGACTCCAGCCTATTGG - Intergenic
1161456166 19:4370668-4370690 TCTTGGAGACTGTTCCCTCTTGG - Intronic
1162599657 19:11658244-11658266 TTCTGGAGTCTGTTGCCTCTCGG - Intergenic
1164234696 19:23322137-23322159 TATAGCTGGCTGTAGCCCCTAGG + Intronic
1164249465 19:23464565-23464587 TATAGCTGGCTGTAGCCCCTAGG + Intergenic
1164302540 19:23974407-23974429 TATAGCTGGCTGTAGCCCCTAGG - Intergenic
1164402835 19:27913464-27913486 CATTGGAGGCTGGAGCCTGCAGG + Intergenic
1168598664 19:57700306-57700328 TATGGAATCCTGTAGCCTCTGGG - Exonic
927403583 2:22742499-22742521 TAGTGGAGGCCATATCCTCTGGG + Intergenic
929014333 2:37479641-37479663 TATAGTAGGCTGTAACATCTAGG - Intergenic
929690532 2:44068858-44068880 CATGGGAAGCTGTTGCCTCTAGG + Intergenic
933099189 2:78230091-78230113 GAATTGAGGCAGTAGCCTCTGGG - Intergenic
939517541 2:143188016-143188038 TGTTGAAGGCAGTTGCCTCTAGG - Intronic
940673627 2:156702053-156702075 TAAAGGAGGCTGTAGACTGTGGG + Intergenic
941282015 2:163563967-163563989 TATAGTAGGCTGTACCATCTAGG - Intergenic
942780288 2:179633810-179633832 TTTTGGTTACTGTAGCCTCTTGG - Intronic
942957939 2:181795964-181795986 TATAGTAGGCTGTACCATCTAGG - Intergenic
943972180 2:194424701-194424723 TATTGTAGGCTGTACCATCTAGG + Intergenic
947595829 2:231411073-231411095 GATGGGAGGCTGGAGGCTCTTGG - Intergenic
1169197544 20:3691641-3691663 CCTTGGGGGCTGGAGCCTCTGGG + Intronic
1170188003 20:13613702-13613724 TGTTTGAGGCTGTAGCCAATTGG + Intronic
1175283765 20:57822822-57822844 TATAGTAGGCTGTACCATCTAGG - Intergenic
1175505330 20:59479711-59479733 TATAGTAGGCTGTACCATCTAGG + Intergenic
1175978686 20:62726275-62726297 TCTTGGAGGCTGGAGCCTCTTGG - Intronic
1176159035 20:63639302-63639324 CATCTGAGGCTGGAGCCTCTAGG - Intergenic
1177337518 21:19750416-19750438 TGTTGTAGGCTGTACCATCTAGG + Intergenic
1179554817 21:42165788-42165810 GATTAGAGGCTTTAGCCACTGGG - Intergenic
1181577386 22:23803550-23803572 TTTTGGAGGGTGTGGGCTCTGGG + Intronic
950494058 3:13323348-13323370 CTTTGGAGGCTGTAGCCTCCTGG + Exonic
950761792 3:15236639-15236661 TATAGTAGGCTGTACCATCTAGG - Intronic
954173866 3:48827539-48827561 TGTTGTAGGCTGTACCATCTAGG - Intronic
955038546 3:55292613-55292635 TATCTGGGGCTGGAGCCTCTAGG - Intergenic
955737061 3:62050407-62050429 TATAGCAGGCTATAGCATCTAGG + Intronic
955795765 3:62635296-62635318 TATTAGAGGCAGAAGGCTCTGGG - Intronic
955867811 3:63403639-63403661 AATTGGAGGTTCTAGCCTCAGGG + Intronic
955894982 3:63689302-63689324 TATTGGAGGCTGTTGGCACAAGG + Intergenic
956053916 3:65278314-65278336 TTCTGGAGGCTGTTGCCTCTGGG + Intergenic
959490930 3:106987858-106987880 TAGTGGAGCCTGTTGCCTCTTGG - Intergenic
960392365 3:117093089-117093111 TATTGGAAGATGTGGCCTTTTGG - Intronic
962304318 3:134272314-134272336 AATTGGAGCCTGCAGACTCTAGG - Intergenic
962418691 3:135207962-135207984 TATTTGAAGGTGGAGCCTCTGGG - Intronic
964233059 3:154493154-154493176 TATTTGAGAATGGAGCCTCTGGG + Intergenic
966328523 3:178784083-178784105 TATTGGCTGCTATAGCCTATGGG + Intronic
970956075 4:21813027-21813049 CATTAGAAGATGTAGCCTCTTGG - Intronic
973027959 4:45297288-45297310 TGTAGGAGGCTGTACCATCTAGG + Intergenic
975492883 4:75007718-75007740 TATTTGAGGATGGGGCCTCTAGG + Intronic
976700121 4:87960490-87960512 TATTGGGAGCTGTGGCCTTTAGG - Intergenic
978101393 4:104844998-104845020 TATAGTAGGCTGTACCATCTAGG + Intergenic
978878158 4:113667035-113667057 TACTCGAGGCTGTAGTTTCTTGG - Intronic
978888064 4:113789625-113789647 TATAGTAGGCTGTAACATCTAGG - Intergenic
979730648 4:124018822-124018844 TACTGGAGGCTGGAGCTCCTGGG + Intergenic
982772770 4:159413311-159413333 TGTAGTAGGCTGTAGCATCTAGG + Intergenic
982991451 4:162281626-162281648 TATGGGAACCTGAAGCCTCTGGG + Intergenic
983433113 4:167676378-167676400 TATTGGAAGTTGGAGTCTCTGGG + Intergenic
985625521 5:983258-983280 AATTGGAGTCTGGGGCCTCTGGG + Intergenic
985928861 5:3039741-3039763 TGTAGTAGGCTGTACCCTCTAGG + Intergenic
986944189 5:12995015-12995037 TATGTGGGGCTGTAGCCTATGGG - Intergenic
991081361 5:62604042-62604064 TATTGTAGGCTGTACCATCTAGG + Intronic
991492127 5:67193914-67193936 TATTGGAGGCTGTCTCCTGGAGG + Intronic
991993247 5:72362218-72362240 TATTAGATGATGTAGCCTTTGGG + Intergenic
992290356 5:75273155-75273177 TGTTGGAAGTTGTAGCCTCATGG + Intergenic
992325135 5:75652845-75652867 TGTTGTAGGCTGTACCATCTAGG - Intronic
993773767 5:91965094-91965116 TATAGAAGGCTGTAACATCTAGG + Intergenic
993955719 5:94230143-94230165 TATTTGAGGCTCTTGTCTCTAGG + Intronic
997290677 5:132731615-132731637 TACTGGAGGTTCTAGCCTCCAGG + Intronic
997440804 5:133907446-133907468 TATGTGAGGCCGTGGCCTCTGGG - Intergenic
1000769835 5:165339138-165339160 TATAGTAGGCTGTACCATCTAGG + Intergenic
1001923730 5:175620927-175620949 TATTGGGAGGTGTAGCCTTTGGG + Intergenic
1001928949 5:175659006-175659028 TCCTGGAGGCGGTTGCCTCTTGG + Intronic
1001928985 5:175659148-175659170 CAGTGGAGGCTGAAGCTTCTGGG - Intronic
1002599780 5:180347532-180347554 GAGAGGAGACTGTAGCCTCTTGG + Intronic
1004134371 6:12952240-12952262 TAATGCAGGCTGTGGACTCTGGG - Intronic
1007714727 6:43849207-43849229 TATTAGAGGTTGGAGCCTCTAGG + Intergenic
1010296063 6:74197395-74197417 TATAGGAAGCTATAGCATCTAGG + Intergenic
1015175730 6:130306080-130306102 TATTGGAAGGTGGAGCTTCTGGG - Intronic
1016076175 6:139798422-139798444 TATAGGAGGCTGTATCATCTAGG - Intergenic
1017202978 6:151775783-151775805 TGCTCTAGGCTGTAGCCTCTAGG - Intronic
1017553010 6:155530149-155530171 TATTGGACAGTGCAGCCTCTGGG + Intergenic
1017785854 6:157756770-157756792 TATTTGACTCTGTTGCCTCTGGG - Intronic
1020279164 7:6641615-6641637 AGTAGGACGCTGTAGCCTCTAGG + Intronic
1023786282 7:43711654-43711676 TGTTGTAGGCTGTACCATCTAGG - Intronic
1024345445 7:48308915-48308937 TGTAGGAGGCTGTATCATCTAGG + Intronic
1025716856 7:63965591-63965613 TATTGGAGGCTGTTGACACGGGG - Intergenic
1027330031 7:77082594-77082616 TATAGTAGGCTGTACCATCTAGG + Intergenic
1029785736 7:102788747-102788769 TATAGTAGGCTGTACCATCTAGG - Intronic
1030516758 7:110548631-110548653 ATTAGGAGGCTATAGCCTCTGGG - Intergenic
1032940895 7:136789836-136789858 TATAGTAGGCTGTACCATCTAGG + Intergenic
1033242414 7:139691008-139691030 CATTGGAGGCTTAAGGCTCTCGG - Intronic
1035303676 7:157916326-157916348 GATGGGCGGCTGGAGCCTCTGGG + Intronic
1041367548 8:57124597-57124619 TACTGGAGGGTGTGGACTCTGGG + Intergenic
1041694248 8:60719010-60719032 TGTAGGAGGCTGTACCATCTTGG + Intronic
1042538206 8:69880557-69880579 TTTTGGGGGCTTTAGACTCTAGG + Intergenic
1042662378 8:71169178-71169200 TATAGCAGGCTGTACCATCTAGG - Intergenic
1043205368 8:77432128-77432150 TATAGGAGGCTATATCCCCTAGG - Intergenic
1043318783 8:78955048-78955070 TATTGGAAGCTATTGCTTCTAGG + Intergenic
1044296502 8:90533951-90533973 TATTGTAGGCTGCACCATCTAGG - Intergenic
1044542736 8:93425943-93425965 TATTAGAAGCTGAAGCCTTTGGG - Intergenic
1045200807 8:99979035-99979057 TATTGAATTCTATAGCCTCTTGG + Intronic
1045366009 8:101476904-101476926 GAGTGGAAGCTGTAGCTTCTGGG - Intergenic
1047608601 8:126498651-126498673 CAGTGGATGCTGTAGCTTCTGGG - Intergenic
1049175370 8:141189424-141189446 TCTGGGAGGCTGTGCCCTCTCGG - Intronic
1051119310 9:13734437-13734459 TATTTGAGGTTGCATCCTCTTGG + Intergenic
1052448280 9:28591803-28591825 TATTGGAGGGTGAAGTCTCCAGG - Intronic
1052953814 9:34236339-34236361 TATAGCAGGCTGTACCATCTAGG + Intronic
1055107533 9:72528076-72528098 TATTAGAAACTGAAGCCTCTGGG + Intronic
1055792653 9:79939255-79939277 TTTGGGAGGCTGCAACCTCTAGG - Intergenic
1056776793 9:89518878-89518900 TCTTGGAAACTGTAGCCTCAGGG + Intergenic
1058650746 9:107173857-107173879 TATAGTAGGCTGTATCGTCTAGG + Intergenic
1059207356 9:112479379-112479401 TATTAGAAGGTGCAGCCTCTAGG + Intronic
1060437223 9:123604342-123604364 TTTGGGATGCTGTAGGCTCTGGG - Intronic
1060834293 9:126743379-126743401 CATGGGATGCTGTTGCCTCTTGG + Intergenic
1061003437 9:127915529-127915551 TTCTGGAGGCGGTAGCCTCCAGG - Intronic
1187737396 X:22318894-22318916 TATAGTAGGCTGTACCATCTAGG - Intergenic
1188158600 X:26773566-26773588 TATTGGAGACTGTAGTCAGTAGG - Intergenic
1191712384 X:64164317-64164339 GACTGATGGCTGTAGCCTCTAGG + Intergenic
1192342605 X:70276713-70276735 TCTTGGAGACTGTCTCCTCTGGG - Exonic
1193876457 X:86868316-86868338 TATTGTAGTCTTTAGTCTCTGGG + Intergenic
1194177316 X:90666048-90666070 TATTTGAGGCTGTTGGCTTTTGG - Intergenic
1199274769 X:145927530-145927552 TATTGTAGGCTTCAGTCTCTGGG - Intergenic
1199672048 X:150155616-150155638 TAGTGGAGCCTGCAGCCTCTGGG + Intergenic
1200523989 Y:4248195-4248217 TATTTGAGGCTGTTGGCTTTTGG - Intergenic
1202303155 Y:23439253-23439275 TTTGGGAGGCTGAAGCCTCGTGG + Intergenic
1202567656 Y:26231341-26231363 TTTGGGAGGCTGAAGCCTCGTGG - Intergenic