ID: 1124090211

View in Genome Browser
Species Human (GRCh38)
Location 15:26592303-26592325
Sequence CAGTTTCACTCTCATATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090211_1124090213 4 Left 1124090211 15:26592303-26592325 CCTCCAATATGAGAGTGAAACTG 0: 1
1: 0
2: 0
3: 9
4: 217
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090211 Original CRISPR CAGTTTCACTCTCATATTGG AGG (reversed) Intronic
906053554 1:42895468-42895490 CAGTTTCATTCTCCTACTTGTGG + Intergenic
908783281 1:67711361-67711383 CACTTTGAGTCTCATATTTGTGG - Intronic
908958071 1:69660328-69660350 CAAATTAACTATCATATTGGGGG + Intronic
909165968 1:72224731-72224753 CAGTTTTACTCCAAAATTGGAGG - Intronic
909674091 1:78219824-78219846 CAGTTTCACTCTCCTACATGTGG - Intergenic
916777107 1:167978648-167978670 TATTTTCACTCTCCTAGTGGTGG + Intronic
919400970 1:197115927-197115949 GAGTTTTACTCTCTTATTAGGGG - Intronic
919659816 1:200233601-200233623 CAGTTTCTTTCTCTTCTTGGAGG - Intergenic
922395574 1:225197238-225197260 CAGTTTCATTCTCCTATATGTGG + Intronic
923875715 1:238044732-238044754 CAGTTTCATTCTCCTATATGTGG - Intergenic
923945267 1:238879116-238879138 CAGTTTCATTCTCCTATATGTGG - Intergenic
924395687 1:243617883-243617905 GTGATTCACTCTCATGTTGGAGG - Intronic
924691936 1:246360742-246360764 CAGTTTCATTCTTCTATAGGTGG - Intronic
1064034677 10:11905692-11905714 CAGTTTCTCCCTCATGTTGCAGG - Intergenic
1064992640 10:21269307-21269329 CATTTGCACTCTCATTTAGGGGG - Intergenic
1068999095 10:63243775-63243797 CTGTCTCCCTCTCATATTTGAGG - Intronic
1071019190 10:81031956-81031978 AAGTTTCACTCTGATATTAGTGG - Intergenic
1072964377 10:99958508-99958530 CAGACTCACTTTCATTTTGGAGG - Intronic
1073152372 10:101320870-101320892 AATTACCACTCTCATATTGGAGG + Intergenic
1074063138 10:109986675-109986697 CAGTTTCATTCTCCTACAGGTGG - Intergenic
1076190263 10:128478268-128478290 CAGGTCCACTCTCACATTGCAGG - Intergenic
1078490025 11:11760024-11760046 CAGATTCAGTCACATATTAGTGG - Intergenic
1081261603 11:40968543-40968565 CAGTCTGACTCTCCTATTAGGGG + Intronic
1082654167 11:55832936-55832958 CAGTTTCATTCTCCTATACGTGG + Intergenic
1082917092 11:58448871-58448893 CAGTTTCATTCTCATACATGTGG - Intergenic
1083127242 11:60582787-60582809 CAGTTTCATTCTCCTATATGTGG - Intergenic
1086259560 11:84922831-84922853 CAGGTTCACGCTCATAGTTGGGG - Intronic
1087732947 11:101799049-101799071 CAGTCACACTCTCATATTCCTGG + Intronic
1087903299 11:103666944-103666966 CAGTGTCTCTCTGACATTGGGGG - Intergenic
1089107780 11:116028530-116028552 CAGTTTCATTCTCCTATATGTGG - Intergenic
1089569383 11:119393539-119393561 CAGTTTCATTCTCCTATATGTGG + Intergenic
1090041239 11:123294070-123294092 CAGTTTCACTATAATCTTAGGGG + Intergenic
1090083682 11:123632294-123632316 CAGATGCACTCTCCTTTTGGAGG + Exonic
1093094443 12:14956732-14956754 CAGATTAACTTTCACATTGGAGG + Intronic
1093408808 12:18840448-18840470 CAGTTTCATTCTCCTACAGGTGG + Intergenic
1094644420 12:32307882-32307904 TTGTTTAACTCTCATATTGGTGG + Intronic
1094721611 12:33070913-33070935 CAGTTTCATTCTCCTATATGTGG + Intergenic
1095375426 12:41522275-41522297 CCCTTTCACTTTCATTTTGGAGG - Intronic
1095531642 12:43193481-43193503 CAGTTTCATTCTCCTATATGTGG + Intergenic
1095687822 12:45055378-45055400 CAGTTTCATTCTCCTACAGGTGG - Intergenic
1095730694 12:45503780-45503802 CAGTGTCTCTGTCATTTTGGGGG - Intergenic
1095893383 12:47255962-47255984 CAGTTTCATTCTCCTACAGGTGG - Intergenic
1097465953 12:59924750-59924772 CAGTTTCATTCTCCTACAGGTGG + Intergenic
1097833266 12:64248028-64248050 CAGTTTCATTCTCCTATGTGTGG + Intergenic
1100966401 12:100017855-100017877 CAGTTTCAATGGAATATTGGGGG - Intergenic
1102916267 12:116755184-116755206 CAGTTTCACTCTCCTACATGTGG + Intronic
1104213028 12:126708511-126708533 CTGTGTAACTCTCATATAGGAGG - Intergenic
1104405438 12:128512754-128512776 CAGGCTCTCTCTCATGTTGGTGG - Intronic
1106578231 13:30996050-30996072 GAGTTTCTCTCTCATCTCGGTGG - Intergenic
1107018064 13:35724313-35724335 CACTTTCAATCACATGTTGGAGG - Intergenic
1108274346 13:48792411-48792433 CAGTTTATCTCTAATAATGGTGG - Intergenic
1108469061 13:50750132-50750154 CAGTTTCATTCTCCTATATGTGG + Intronic
1109555445 13:63968897-63968919 CAGTTTCATTCTCCTATATGTGG - Intergenic
1109735479 13:66478992-66479014 CAGGTTAACTCTCTTATTAGGGG + Intronic
1110321888 13:74169940-74169962 CAATTTGACTCTCATAAAGGTGG - Intergenic
1111165359 13:84451013-84451035 CAGTTTCACTCTCCTACATGTGG + Intergenic
1111877325 13:93913459-93913481 CAGCTTCACTCTCACAATGTTGG + Intronic
1112516965 13:100061909-100061931 CAGTTTCATTCTCCTATGTGTGG + Intergenic
1113317850 13:109202990-109203012 CAGTTTCATTCTCCTATATGTGG - Intronic
1113321064 13:109232624-109232646 CATTTTCACTCTAATTTTGGGGG + Intergenic
1115350268 14:32386803-32386825 CAGTTTCATTCTCCTACTCGTGG + Intronic
1116732398 14:48640635-48640657 CAGTTTCATTCTCCTATATGTGG - Intergenic
1117514506 14:56487319-56487341 CAGTTTCACACTCATTTGTGGGG + Intergenic
1117875594 14:60248467-60248489 CAGTTGCACTCGCACATTGGTGG + Intronic
1118061914 14:62148717-62148739 CAGTTTCATTCTCCTATGTGTGG - Intergenic
1119068440 14:71555102-71555124 CAGTCTGACTCTCTTATTAGGGG - Intronic
1120304500 14:82751627-82751649 CAGTATCAGTCTCATATTTGGGG - Intergenic
1121460283 14:94070803-94070825 CAGTTTCATTCTCCTACAGGTGG - Intronic
1202846939 14_GL000009v2_random:186297-186319 CAATTTCACTCTCACAATGTAGG - Intergenic
1124090211 15:26592303-26592325 CAGTTTCACTCTCATATTGGAGG - Intronic
1124116365 15:26846890-26846912 TACTTTCACTCACATGTTGGGGG + Intronic
1125268950 15:37916830-37916852 CAGTTTCACTCTCCTACATGTGG + Intergenic
1128415471 15:67441680-67441702 CAGTTTCACTCTCCTAAATGTGG - Intronic
1129046712 15:72741718-72741740 CAGTTTCATTCTTCTATTTGTGG - Intergenic
1130790577 15:87151791-87151813 AAATTTCACTCTCATATTCAAGG + Intergenic
1137372150 16:47917507-47917529 CAGTTTGAGTCTTAAATTGGGGG + Intergenic
1137916651 16:52438938-52438960 CAGTTTGATTCACATATTGTAGG + Exonic
1139194187 16:64898934-64898956 AAGTTTCTCTATCATTTTGGGGG + Intergenic
1141460680 16:84177009-84177031 CAGGTGCACTCCCAAATTGGGGG + Intronic
1141777075 16:86131174-86131196 CTGTTTCACTTTCCTATTGTTGG + Intergenic
1144081200 17:11765889-11765911 GAGCTACTCTCTCATATTGGTGG + Intronic
1146583801 17:34064320-34064342 CAGTTTCATTCTCCTACAGGTGG - Intronic
1148037637 17:44680001-44680023 CAGTCTCACTCTCATATCCCAGG + Intronic
1149934849 17:60794601-60794623 CAGTTTCATTCTCCTACAGGTGG + Intronic
1153288008 18:3474279-3474301 CAGGTTGACTCTCTTATTAGGGG + Intergenic
1156010865 18:32496267-32496289 CAGTTTCACTCTCCTACATGTGG + Intergenic
1156629235 18:38946734-38946756 CAGGTTAACTCTCTTATTAGGGG + Intergenic
1159225902 18:65535592-65535614 CAGTTTCACTCTCCTACATGTGG - Intergenic
1159786924 18:72726023-72726045 CAGTTTCATTCTCCTACTTGTGG + Intergenic
1160267114 18:77348358-77348380 CAGTTTCATTCTCCTATATGTGG + Intergenic
1160611452 18:80090421-80090443 CAGATTCATTCTACTATTGGAGG - Intronic
1167626954 19:50596966-50596988 CAGGTTGACTCTCATTTTAGGGG + Intergenic
932316430 2:70787060-70787082 CTATCTCACTCTCATAATGGTGG + Intronic
932653567 2:73586444-73586466 CAGTTTCATTCTCCTATATGTGG + Intronic
932848790 2:75163011-75163033 CACTTTCACTCACATTTTGTTGG - Intronic
935395126 2:102599618-102599640 CGGTTTCACTCTCCTCCTGGGGG + Intergenic
935574385 2:104693762-104693784 CAGTTTTACTCCAATATTTGGGG + Intergenic
936020027 2:108987810-108987832 CAGAGTCACTCTCTTTTTGGTGG + Intronic
936079691 2:109423793-109423815 CAGGCTCACTCTCATATTCTTGG - Intronic
937972013 2:127557787-127557809 CAGTTTCACTCTCCTACATGTGG - Intronic
940005297 2:149004577-149004599 AACTTTCACTGTCATCTTGGGGG - Intronic
943658310 2:190532301-190532323 CAGTTTCATTCTCATATTCTTGG - Intronic
944923940 2:204443738-204443760 CAGTTTCCCTTTCTTATTGATGG - Intergenic
945373838 2:209055487-209055509 CAGTTTCACTCTCCTACATGTGG - Intergenic
946105871 2:217368995-217369017 CACTTCCACTCTCTTCTTGGTGG + Intronic
947941854 2:234063847-234063869 CAGTTTCTCTCTCTTATTTTGGG - Intronic
1169609854 20:7366058-7366080 CAGTTTCACTACCACATTGAAGG - Intergenic
1170118413 20:12886078-12886100 CATTCCCACTCTCATAGTGGAGG - Intergenic
1170245370 20:14216203-14216225 CAGTTTCATTCTCCTACAGGTGG + Intronic
1172307534 20:33891930-33891952 CAGTTTCACTCTTATTTTCCAGG + Intergenic
1174764591 20:53240865-53240887 CTGTTTCATTCTCCTTTTGGGGG - Intronic
1178005084 21:28209678-28209700 CAGTTTTTCTATCATATTGTGGG + Intergenic
1179318265 21:40265802-40265824 CAGTTTCGCTCTTATATATGTGG - Intronic
1179933453 21:44587818-44587840 CAGTTTCATTCTCCTATATGTGG - Intronic
1180099229 21:45576684-45576706 CAGCTTCAGCCTCATTTTGGAGG - Intergenic
1182079346 22:27518167-27518189 CAGTTTCTCTGTCCTGTTGGGGG + Intergenic
1183125089 22:35770199-35770221 AAGTTTGACTTTCCTATTGGAGG - Intronic
1184254517 22:43279466-43279488 CAGTTTCAACATCATTTTGGAGG - Intronic
950598838 3:14012599-14012621 CAGTTTCATTCTCCTATATGTGG + Intronic
951093188 3:18598783-18598805 CAAAGTCACTTTCATATTGGTGG + Intergenic
952114773 3:30165482-30165504 CATTGTCACTGTAATATTGGAGG + Intergenic
952395151 3:32914625-32914647 CTGTTTCACTCTCAGACTAGAGG + Intergenic
955175228 3:56606839-56606861 CAGTTTCATTCTCCTATATGTGG + Intronic
956176884 3:66481298-66481320 AAAGTTCACTCTGATATTGGTGG + Intronic
956763663 3:72465621-72465643 CAGTTTCACTTTAATAGTGAGGG + Intergenic
957015829 3:75064015-75064037 CAGTTTCATTCTCCTATATGTGG + Intergenic
957086256 3:75680804-75680826 CAGTTTCATTCTCCTACTTGTGG - Intergenic
960117694 3:113912825-113912847 CCCTTTCTCTCTCCTATTGGTGG - Intronic
960497128 3:118387959-118387981 CTGTTTCTCTCTCCAATTGGGGG - Intergenic
962935594 3:140077665-140077687 CAGTTTCCCTCTCATGTAGAGGG + Intronic
963507738 3:146208223-146208245 CAGTTTCATTCTCATACATGTGG - Intronic
963674292 3:148289034-148289056 TAGTTACACTCACCTATTGGAGG - Intergenic
964930114 3:162009046-162009068 CAGTCTAACTCTCATGTTAGGGG - Intergenic
967559284 3:190899492-190899514 CAGTTTCATTCTCCTATATGTGG - Intergenic
971553751 4:27985728-27985750 CAGTTTGACTTTCATATTTAAGG + Intergenic
971754317 4:30687602-30687624 CAGTTCCACTCTAATAGTAGGGG - Intergenic
973831108 4:54760028-54760050 CAGTTTCACTCTCCTACATGTGG + Intergenic
974008885 4:56588821-56588843 CAGTTTCATTCTCCTACTTGTGG + Intronic
974184360 4:58427495-58427517 CAGTTAAACTCTGATTTTGGTGG + Intergenic
977295694 4:95206491-95206513 CTGTTTCTCTCTCATTTTGAGGG + Intronic
977331953 4:95647479-95647501 CAGTTTCCTCCTCATATTGAGGG + Intergenic
981335666 4:143566327-143566349 CAGTTTCATTCTCCTACTTGTGG + Intergenic
982273954 4:153620981-153621003 CATTTACACTCTCATATTATCGG - Intronic
982300571 4:153874834-153874856 CAGTTTCACTTCCATATTAAAGG - Intergenic
982903061 4:161031271-161031293 CAGGTTGACTCTCTTACTGGGGG - Intergenic
982951015 4:161696156-161696178 CAGTTTCATTCTCCTACTTGTGG + Intronic
982974970 4:162044555-162044577 CAGGTTCACTCTCTTGTTAGGGG - Intronic
983544474 4:168948563-168948585 CAGTTTCACTCTCCTACATGTGG + Intronic
986900642 5:12428578-12428600 CAGGTCCACTCTCCTTTTGGAGG + Intergenic
987030013 5:13967374-13967396 CAGTTTCATTCTTATATATGTGG + Intergenic
987970587 5:24938964-24938986 CAGTGACACACTCATTTTGGTGG - Intergenic
989361827 5:40610340-40610362 CACTTTATCTCTCTTATTGGAGG + Intergenic
993277437 5:85878662-85878684 CAGTTTCATTCTCCTACAGGTGG + Intergenic
993601174 5:89926767-89926789 CAGTTTCATTCTCCTATGTGTGG - Intergenic
994875702 5:105418322-105418344 CAGTTTCATTCTCCTATATGTGG - Intergenic
998603537 5:143609688-143609710 CAGTTTCATTCTCATACATGTGG - Intergenic
998941275 5:147285246-147285268 CAGTTTCATTCTCCTACTTGTGG - Intronic
999819205 5:155208151-155208173 CAGTTTCATTCTCCTATATGCGG - Intergenic
1000825454 5:166038507-166038529 CAGTTTCACTTACATTTCGGAGG - Intergenic
1005792788 6:29323454-29323476 CAGTTTCATTCTCCTATATGTGG + Intergenic
1007891966 6:45303062-45303084 CAGTTTCACTCTCCTTTATGTGG - Intronic
1008190609 6:48452436-48452458 CAGTTTCATTCTCCTATATGTGG - Intergenic
1008214738 6:48774442-48774464 AAGTTTCAGTCTCATGTGGGTGG + Intergenic
1008536592 6:52510692-52510714 CAGGTTCACTCTGAGTTTGGAGG + Intronic
1008735931 6:54544031-54544053 CAGTTTCACTCTCCTATATGTGG + Intergenic
1009495292 6:64338927-64338949 CAGTTTCATTCTCCTATATGTGG - Intronic
1010015147 6:71096457-71096479 CAGTTTTATTCTCTTATAGGTGG + Intergenic
1011537195 6:88389036-88389058 CCTTTTCACTCTCTTAATGGTGG + Intergenic
1015361966 6:132350322-132350344 CAGTTTCACTCTCCTACATGTGG + Intronic
1016663350 6:146606598-146606620 CAGTTTCAATCTCCTATAGATGG + Intronic
1017261520 6:152393107-152393129 CAGTTTCAGTCTGATATTCCAGG - Intronic
1019116255 6:169764911-169764933 CTGTTTCTGTCTCATCTTGGAGG + Intronic
1019629226 7:2038056-2038078 CAGTTTCACTTTCTTATCGTTGG - Intronic
1022984916 7:35643108-35643130 CAGTTTCTCTCTATTATTAGAGG - Intronic
1024126828 7:46307164-46307186 CAGTTTCATTCTCCTATATGTGG - Intergenic
1025221040 7:57108106-57108128 GAGTTTCACTCTCATTTTCCAGG + Intergenic
1025631854 7:63279918-63279940 GAGTTTCACTCTCATTTTCCAGG + Intergenic
1027753008 7:82175211-82175233 CAGTTACACTCCCATAATGTTGG + Intronic
1028008668 7:85612602-85612624 CAGTTTCATTCTTCTATTTGTGG - Intergenic
1028506420 7:91575855-91575877 CAGTTTCATTCTCCTATATGTGG + Intergenic
1028660964 7:93274325-93274347 CAGGTTGACTCTCTTATTAGGGG + Intronic
1029308499 7:99639701-99639723 CAGTTTCAGTGGCATAGTGGGGG + Intergenic
1030107060 7:105996247-105996269 CAGTTTCCATCTCATCGTGGAGG + Exonic
1030548846 7:110932915-110932937 CAGGTTCACCCTCCTATTGCAGG - Intronic
1031095338 7:117411755-117411777 CAGTTTCATTCTTATAGTAGGGG - Intronic
1036109385 8:5880481-5880503 CAGTTTCACTCTCCTACATGTGG - Intergenic
1036150424 8:6292079-6292101 CAGTCTCACTCACATGTTTGCGG + Intergenic
1037358507 8:18048310-18048332 CAGTTTCATTCTCATACATGTGG - Intergenic
1037560412 8:20068730-20068752 CAGTTTCATTCTCATACATGTGG - Intergenic
1039344680 8:36690675-36690697 TAGTTTCACTGTAATATTGCTGG - Intergenic
1044093910 8:88038497-88038519 CAGTTTCTTTCTCATTTTAGAGG + Exonic
1045246239 8:100443935-100443957 CAGTTTGACTCTGATATTAGTGG + Intergenic
1045522640 8:102916594-102916616 CAGTGTCAGTCTCATCTCGGAGG + Intronic
1046205069 8:110983417-110983439 CACTTTCACTCTCATACTTCAGG - Intergenic
1046308187 8:112398402-112398424 CTGTTTCATGATCATATTGGTGG + Intronic
1047929626 8:129713738-129713760 CAGTGTCACTCTTTTATTGGGGG - Intergenic
1048731884 8:137451307-137451329 TAGTTTCATTCCAATATTGGTGG - Intergenic
1050503211 9:6320442-6320464 CAGTTTCATTCTCCTACAGGTGG - Intergenic
1051266025 9:15309086-15309108 CAGTTTCACTCTCATCTCCCAGG + Intergenic
1051388916 9:16542275-16542297 ATGTTTCACTCTCTTATTTGGGG + Intronic
1051608700 9:18941176-18941198 CAGTTTGAATCCTATATTGGGGG - Intronic
1052307015 9:27022028-27022050 CAGTTTCATTCTCCTACTTGTGG + Intronic
1052346971 9:27419598-27419620 CAGTTTCATTCTCCTACTTGTGG - Intronic
1052600562 9:30623612-30623634 CAATTTTACTCTCAAATAGGTGG - Intergenic
1056079552 9:83077488-83077510 CATTTTCACTCTGATAGGGGAGG - Intergenic
1056810988 9:89763781-89763803 CAGCTTCACTCCCACATTGCTGG + Intergenic
1058624222 9:106917513-106917535 TAACTTCAGTCTCATATTGGGGG + Intronic
1059815612 9:117909804-117909826 CAGTTTCATTCTCCTATATGTGG - Intergenic
1203758527 Un_GL000218v1:158852-158874 CAATTTCACTCTCACAATGTAGG - Intergenic
1185573227 X:1150642-1150664 GAGTTTCACTCTCATCTTCCAGG - Intergenic
1187785243 X:22877460-22877482 AAATTTCAGTCTCAAATTGGTGG - Intergenic
1188645583 X:32563007-32563029 CAGTTACACGCTCCTATTGTGGG - Intronic
1189218570 X:39349571-39349593 CAGTTTCATTCTCCTACAGGTGG - Intergenic
1190412915 X:50154700-50154722 CAGTTTCACATTTACATTGGGGG + Intergenic
1191660167 X:63641324-63641346 GAGTTTCACTCTCATCGTGCAGG - Intronic
1191891914 X:65952547-65952569 CAGTTTCATTCTCCTATATGTGG + Intergenic
1193061509 X:77212933-77212955 CAGATTCATTCTCATCTTTGTGG - Intergenic
1193269656 X:79514670-79514692 CATTTTCACTCCCTTATTGAAGG + Intergenic
1193589936 X:83376718-83376740 CAGTTTCATTCTCCTGTAGGTGG + Intergenic
1193992487 X:88325058-88325080 CAGTTTCACTCTTCTATATGTGG + Intergenic
1194273082 X:91844403-91844425 CAGTATCACTGTCATATGGAGGG - Intronic
1195818401 X:108914480-108914502 CAGTTTCATTCTCCTATATGTGG - Intergenic
1196620010 X:117810727-117810749 CAGTTTCATTCTCCTATATGTGG - Intergenic
1196883577 X:120222735-120222757 CACTTTCACTCTCCTATTTTAGG - Intergenic
1198510700 X:137348477-137348499 CAGTTTCACTCTCCTACATGTGG - Intergenic
1198894634 X:141439371-141439393 CAGTTTCATTCTCCTATATGTGG + Intergenic
1200590326 Y:5065801-5065823 CAGTATCACTGTCATATGGAGGG - Intronic