ID: 1124090212

View in Genome Browser
Species Human (GRCh38)
Location 15:26592306-26592328
Sequence CTTCAGTTTCACTCTCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090212_1124090213 1 Left 1124090212 15:26592306-26592328 CCAATATGAGAGTGAAACTGAAG 0: 1
1: 0
2: 5
3: 86
4: 342
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090212 Original CRISPR CTTCAGTTTCACTCTCATAT TGG (reversed) Intronic
902112616 1:14095246-14095268 TTTCATTCTCACTCTCATCTAGG + Intergenic
907564151 1:55419086-55419108 TTTCTGTCTCACTTTCATATAGG - Intergenic
908451018 1:64254915-64254937 ATTCAGTTCCACTCTGATCTTGG - Intronic
909047216 1:70725113-70725135 CTTCAGTTCCACTCTGACCTTGG + Intergenic
909049270 1:70748888-70748910 CTTTAGTTCCACTCTGATCTTGG + Intergenic
909137064 1:71814904-71814926 CTTCAGTTCCACTCTGATCTTGG + Intronic
909285403 1:73810173-73810195 CTTCAATTCCACTCTGATCTTGG + Intergenic
909678104 1:78260256-78260278 CTTCAGTTTCACGCTTATCTTGG - Intergenic
911504297 1:98729423-98729445 CTTTAGTTCCACTCTGATCTTGG - Intronic
912227280 1:107748710-107748732 CTTCTGTTTGACTTTCTTATAGG - Intronic
912803987 1:112741672-112741694 CTTCAGTTTCACCCACCCATCGG - Intergenic
913521958 1:119652995-119653017 CTTCAGCTTTACTCTCAGAAAGG - Intergenic
913709324 1:121465761-121465783 CTTAAGTTACATTCTTATATTGG + Intergenic
917269919 1:173261470-173261492 CTTCAGTTTCACTCTGATCTTGG - Intergenic
917290155 1:173463868-173463890 CTTCAGTTCTACTCTGATTTTGG - Intergenic
917674443 1:177305559-177305581 TTTCAGCTTCCCTCTCAGATTGG + Intergenic
917802756 1:178585219-178585241 CTTCAGGTTCTCTCTTAGATGGG + Intergenic
918273140 1:182922893-182922915 ATTCAGTTCCACTCTAATTTTGG - Intronic
918747166 1:188218433-188218455 CTTCATTTTCACTGTCAGATAGG - Intergenic
919231650 1:194781471-194781493 CTTCAGTTCCACTCTGATCTTGG - Intergenic
919508042 1:198424879-198424901 CTTCAGTGTCATTAGCATATCGG - Intergenic
922108798 1:222537346-222537368 ATTCATTTTCACCATCATATTGG - Intronic
924862933 1:247945005-247945027 CTTCAGTTTCTCTCTGATCTTGG + Intronic
924871907 1:248056351-248056373 CTTCAGTTCCACCCTGATCTTGG + Intronic
1063778225 10:9288980-9289002 CTTCAGTTACATTCTAATATTGG - Intergenic
1064436021 10:15311895-15311917 CTTCAGTTTCACTGGCACCTTGG - Intronic
1064992643 10:21269310-21269332 GTTCATTTGCACTCTCATTTAGG - Intergenic
1068493269 10:57751243-57751265 CTTCAGTTCTGCTCTAATATTGG + Intergenic
1068571554 10:58635128-58635150 GTTCAGTTTCATTCTCTTAGAGG + Intronic
1069768652 10:70883349-70883371 CTTCAGATTCATTATCATCTAGG - Intronic
1070512982 10:77177877-77177899 CTAAAGTTTCAATCTCATTTTGG - Intronic
1071095953 10:81975002-81975024 CTTCAGTTTTAGTATCTTATTGG + Intronic
1073863495 10:107773726-107773748 CTTCAGTTCCACTCTGATTTTGG - Intergenic
1074683555 10:115935472-115935494 CTTCTGGTTCACAATCATATGGG + Intronic
1075230713 10:120674379-120674401 CTTCAGTTCCACACTGATCTTGG - Intergenic
1075860517 10:125672128-125672150 CTTCAGTTTCGCTCTGATCTTGG + Intronic
1075899335 10:126026913-126026935 CTTCAGTTCCACTCTGATCTTGG - Intronic
1076292126 10:129353653-129353675 CTTTAGCTCCACTCTCATACTGG - Intergenic
1079276556 11:19043120-19043142 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1079580074 11:22053128-22053150 CTTCAGTTCTACTCTGATCTGGG + Intergenic
1079705793 11:23616228-23616250 CTTCTGTTCCACTCTGATCTTGG + Intergenic
1080221254 11:29907711-29907733 CTTCAGTTTAGCTCTGATCTTGG - Intergenic
1080256786 11:30299017-30299039 CTTCAGTTCTACTCTAATTTTGG - Intergenic
1080553484 11:33394632-33394654 GTCCCATTTCACTCTCATATTGG + Intergenic
1081272229 11:41098832-41098854 CTTCAGTTCAGCTCTGATATTGG - Intronic
1082674388 11:56077966-56077988 CTTCAGTTCCACTCTGAGCTTGG + Intergenic
1083527810 11:63386892-63386914 CTTCAGTTGCACTCTGATCTTGG + Intronic
1085220792 11:74872337-74872359 CTACAGTTTCCTTCTAATATTGG - Intronic
1085634916 11:78151319-78151341 CATCAGTTTCCCTCTCCCATTGG + Intergenic
1085983081 11:81748394-81748416 CTTCAGTTTCAGTATAATAAAGG - Intergenic
1086820478 11:91430600-91430622 TTTCAGTTCCACTCTGATCTTGG + Intergenic
1087513203 11:99124609-99124631 CTTCAGTTTAGCTCTGATTTTGG - Intronic
1087513823 11:99131399-99131421 CTTCAGTTCCACTCTGAGCTTGG - Intronic
1088103913 11:106184635-106184657 CTACAGTCTCACTCTCATATGGG + Intergenic
1090114402 11:123952790-123952812 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1091595470 12:1875840-1875862 CTTCAATGTCACTCTCAAAATGG + Intronic
1092796484 12:12114899-12114921 CTTCATTTTAACTTCCATATTGG + Intronic
1092952560 12:13520868-13520890 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1093085192 12:14859368-14859390 CTTCAGTTCCACTCTGATCTTGG + Intronic
1093239833 12:16656628-16656650 CTTCAGTTTGGCTCTGATTTTGG + Intergenic
1094014802 12:25850935-25850957 GTTCAGATTGACTCTCATAAAGG + Intergenic
1094644419 12:32307879-32307901 GTTTTGTTTAACTCTCATATTGG + Intronic
1094672524 12:32584888-32584910 CTTCATTTTCCCACTCCTATGGG - Intronic
1094694706 12:32806715-32806737 CTTCAGTTCCACTCTGATCTTGG + Intronic
1094788518 12:33880878-33880900 CTTCAGTTCTACTCTGATCTTGG - Intergenic
1095120914 12:38417459-38417481 CTTCTGTTTCATTCCCCTATTGG - Intergenic
1096792138 12:54051936-54051958 CTTCAGTCTCCCTCTCACAAGGG + Intronic
1097102907 12:56601886-56601908 CTTCAGCTTCAGTCCCATAAGGG - Exonic
1097814969 12:64063109-64063131 TTTGAGTTTCAGTCTCACATGGG + Exonic
1097910412 12:64963728-64963750 CTTCAGTTTAGCTCTGATCTTGG + Intergenic
1098007249 12:66010624-66010646 GTTCAGTCTCAGTCTCAGATAGG - Intergenic
1098046278 12:66404085-66404107 CTTCAGTTGCACTTTCTTTTGGG - Intronic
1098830286 12:75353138-75353160 CTTTAGTTTCACTCTGATCTTGG - Intronic
1099868253 12:88312483-88312505 CTTCAGCTTCAGTCTCTTTTGGG - Intergenic
1100513398 12:95300409-95300431 GTTCATCTTCACTCTCACATTGG - Exonic
1101038168 12:100725754-100725776 CATCCGTTTCACTCTGATTTGGG - Intronic
1101307866 12:103547719-103547741 CTTCAGTTCCACACTGAAATTGG - Intergenic
1102675319 12:114654151-114654173 CTTCAGTTCCTCTCTCTTCTTGG - Intergenic
1105393003 13:19999464-19999486 AATTAGGTTCACTCTCATATGGG - Intronic
1105758785 13:23494246-23494268 GTTCAGTTTCACTTTAATGTCGG + Intergenic
1105831950 13:24170442-24170464 CTTCAGTTTCTCTCTCATTCTGG + Intronic
1106349446 13:28914109-28914131 CTTCAGTTCCACTCTGATCTTGG + Intronic
1107241003 13:38233911-38233933 CTTCAGTTTCATTCTAATCTTGG - Intergenic
1107389427 13:39947975-39947997 CTTCAGTTTAGCTCTCATTTGGG - Intergenic
1107395323 13:40009734-40009756 CATCAGTTCCACTCTGATCTTGG + Intergenic
1107466438 13:40654929-40654951 CTTCAACTTCATTCTCATCTTGG - Intronic
1108047635 13:46398352-46398374 CCTCAGTTTCAATATCCTATTGG + Intronic
1108173681 13:47770489-47770511 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1108479981 13:50859056-50859078 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1108881730 13:55128452-55128474 ATTCAGTGGCACTCTCACATAGG + Intergenic
1108964996 13:56287341-56287363 ATTCAGTTTGGCTCTCATTTGGG + Intergenic
1109072221 13:57784544-57784566 CTTCAATTCCACTCTGATCTTGG + Intergenic
1109426875 13:62176425-62176447 CTTCAGCTCCACTCTGATCTTGG - Intergenic
1110128998 13:71983066-71983088 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1111283997 13:86064380-86064402 CTCCATTTTCACTCTGACATGGG + Intergenic
1111332551 13:86778952-86778974 CTTCAGTTCCACTTTGATCTTGG + Intergenic
1111697584 13:91644265-91644287 GTTCAGTTTACCTCTCATAGAGG + Intronic
1115067523 14:29282889-29282911 TTCAAGTTTCACTCTCATTTTGG + Intergenic
1115927497 14:38451864-38451886 CTTCAGTTCCACTCTAGTCTTGG - Intergenic
1115938049 14:38577640-38577662 TTTCTGGTTCACTCTCATTTGGG + Intergenic
1116066803 14:39994760-39994782 CTTCAGCTTGACTCTGATTTTGG + Intergenic
1117270479 14:54138401-54138423 TTTCACTTTCACTCTCAGAAAGG + Intergenic
1118448526 14:65874686-65874708 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1119683744 14:76613454-76613476 CTTCATTTTCTCTTTCATATGGG - Intergenic
1120290436 14:82563270-82563292 CTTCATATTCACTCTGATCTAGG - Intergenic
1120421258 14:84289138-84289160 CTTTAGTTTCAATTTCATCTTGG - Intergenic
1120617743 14:86729069-86729091 CTACAGTCTCAAACTCATATAGG + Intergenic
1120630802 14:86887565-86887587 CTTCAGTTCCACTCTGATTTTGG + Intergenic
1121003528 14:90470688-90470710 CTTCAGTTCCACTCTAATCTGGG + Intergenic
1121776861 14:96597073-96597095 CTTAAGTTTCACTCGCTTCTCGG + Intergenic
1122383185 14:101324764-101324786 CTTCCGTTTCACTCACTTCTTGG + Intergenic
1123848271 15:24326776-24326798 GAACAGTTTCACTCTCAAATGGG - Intergenic
1123867332 15:24534299-24534321 GAACAGTTTCACTCTCAAATGGG - Intergenic
1123923929 15:25090286-25090308 GTTCACTTTCACCCTCATTTGGG + Intergenic
1124090212 15:26592306-26592328 CTTCAGTTTCACTCTCATATTGG - Intronic
1124197225 15:27642247-27642269 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1124224597 15:27881869-27881891 CTTCGGCTTCACTCTGATCTTGG + Intronic
1125274306 15:37974743-37974765 CTTCAGTTTGCCTCTGATTTTGG + Intergenic
1125373564 15:39003942-39003964 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1126505863 15:49403757-49403779 CTTCAGTTTAGCTCTGATTTTGG + Intronic
1126784573 15:52166825-52166847 CTTTAGTTCCACTCTGATCTTGG - Intronic
1126871423 15:52992546-52992568 CTTCAGTTTAGCTCTGATCTTGG + Intergenic
1126923951 15:53561038-53561060 CTTCAGTTCTACTCTTTTATTGG + Intronic
1130026970 15:80278428-80278450 CTTCTGTCTCACTCTCAGAAAGG + Intergenic
1130186179 15:81685551-81685573 CTTGAGTTTCTCTCTTATATGGG - Intergenic
1130545440 15:84854590-84854612 ATTCATTTTCTATCTCATATTGG + Intronic
1131240853 15:90741811-90741833 TCTCATTTTCACTCCCATATTGG - Intronic
1133976650 16:10603874-10603896 CTTCAGTGTCACACTCAAGTAGG + Intergenic
1135948548 16:26889105-26889127 CATCAGTTTTACTTTCCTATTGG + Intergenic
1136643232 16:31586046-31586068 CTTCAGATCCACTCTGATCTTGG + Intergenic
1136644833 16:31604303-31604325 CTTTAGATTCACTTTCATTTTGG - Intergenic
1136660329 16:31752962-31752984 CTTTAGATTCACTTTCATTTTGG + Intronic
1136662384 16:31774742-31774764 CTTCAGATCCACTCTGATCTTGG - Intronic
1139803679 16:69545394-69545416 CTTCTGTTTCATTCTAAAATAGG - Intergenic
1140595344 16:76402553-76402575 CTTCAGTTTAGCTCTGATTTTGG + Intronic
1140655902 16:77139451-77139473 GTTCAGATTTTCTCTCATATTGG + Intergenic
1141460677 16:84177006-84177028 CTTCAGGTGCACTCCCAAATTGG + Intronic
1144432227 17:15203999-15204021 CTTCAATTTCACTCTGAGCTTGG - Intergenic
1146771968 17:35577325-35577347 CTCCAGCTTCACTTTCAGATAGG + Exonic
1149992391 17:61390305-61390327 CTTCAGTATCACCCTAATCTGGG - Intronic
1151845107 17:76648185-76648207 CTGCAGTTTCACTCTAAGAAGGG - Intergenic
1155430055 18:25745653-25745675 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1155723189 18:29045393-29045415 CTTCAGTTCAGCTCTCATTTTGG + Intergenic
1156016122 18:32549096-32549118 CTTGTGATTCATTCTCATATTGG - Intergenic
1157900595 18:51512774-51512796 TTTCAGTTCCACTCTGATCTTGG + Intergenic
1158366489 18:56743270-56743292 CTCAAGTTTCACTCTCTTAAAGG - Intronic
1158412988 18:57224061-57224083 TTTCAGTTCCACTCTCTTCTTGG - Intergenic
1158790698 18:60777194-60777216 CTTCAGTTCAACTCTAATTTTGG - Intergenic
1158795594 18:60842198-60842220 CTTCAGTTCAACTCTGATTTTGG - Intergenic
1160181813 18:76643373-76643395 CCTCAGTTTCACTCACGTATTGG + Intergenic
1162612122 19:11764709-11764731 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1164496720 19:28771676-28771698 CTTCAGTTCAACTCTCATTTTGG + Intergenic
1164600043 19:29555552-29555574 CTTTAGTTCCACTCTGATCTTGG - Intronic
1166904488 19:46097510-46097532 CTTCAGTTCCATTCTGATCTTGG + Intergenic
1168129759 19:54310780-54310802 CTCCAGTATCACTCTGATGTTGG - Intronic
1168189263 19:54726121-54726143 CTTCAGTGTCGCTCTCGTCTTGG + Exonic
1168191272 19:54740335-54740357 CTTCGGTGTCACTCTTATCTTGG + Intronic
1168195598 19:54771677-54771699 CTTCAGTGTCATTCTTATCTTGG + Intronic
1168197501 19:54786531-54786553 CTTCAGTGTCGCTCTCGTCTTGG + Intronic
1168203973 19:54835907-54835929 CTTCAGTGTCACTCTAATCTTGG + Intronic
1168281232 19:55306428-55306450 CGTCACCTTCACTCTCATCTCGG + Exonic
1168553087 19:57315402-57315424 ATTCAGTTCAACTCTGATATTGG + Intergenic
926987058 2:18636247-18636269 CTTCAGTTCAGCTCTGATATTGG + Intergenic
928215739 2:29360018-29360040 CCTCAGTTTCCCTCTCATAATGG + Intronic
928216167 2:29363132-29363154 CCCCAGTTTCTCTCTCATAATGG + Intronic
928386721 2:30875506-30875528 CTTCAGTTCCACTCTGATCTTGG - Intergenic
928482059 2:31692951-31692973 CTGCAGTTTCCTTCTAATATTGG + Intergenic
928728911 2:34208018-34208040 CTTCAGTTCCACTCTGATTTTGG - Intergenic
929340473 2:40809620-40809642 CTTCAGTTTCTCACTGATAAAGG + Intergenic
930282639 2:49388926-49388948 CTTCAGTTTAGCTCTGATTTTGG - Intergenic
930522889 2:52490102-52490124 CTTCAGTTCCACTATGATCTTGG + Intergenic
930805035 2:55482239-55482261 CTTCAATTTCTCTCTCTTTTTGG - Intergenic
931508846 2:62965432-62965454 TTTCAATTTCACTCTCATTAAGG - Intronic
933465417 2:82644858-82644880 CTTCAGTTCCACTCTGATCTTGG - Intergenic
933482855 2:82878893-82878915 CTTCACTTCCACTCTGATCTTGG - Intergenic
934148460 2:89119753-89119775 CTTCAGTTCAACTCTGATTTTGG - Intergenic
934218830 2:90062257-90062279 CTTCAGTTCAACTCTGATTTTGG + Intergenic
934620589 2:95801574-95801596 CTTCAGTTCAACTCTTATTTTGG + Intergenic
934812850 2:97298149-97298171 CTTCAGTTCAACTCTTATTTTGG - Intergenic
934824845 2:97410323-97410345 CTTCAGTTCAACTCTTATTTTGG + Intergenic
936957361 2:118036070-118036092 CTTCAGTTCCCCTCTGATCTTGG + Intergenic
937621414 2:123992049-123992071 CCTCAGGTTTACTCCCATATTGG + Intergenic
937827003 2:126377677-126377699 CTTCAGTTCAGCTCTCATTTTGG + Intergenic
939298210 2:140297452-140297474 CTTCAGTTGCATTCGCCTATGGG + Intronic
939365235 2:141222070-141222092 CTTGAGTTCCACTCTGATCTGGG - Intronic
940447183 2:153789585-153789607 CTTCAGTTCAACTCTGATTTGGG - Intergenic
941408577 2:165123730-165123752 CTTCAGGTGCACACTTATATTGG - Intronic
941742996 2:169055967-169055989 TTTCTGTTCCACTCTCATCTTGG - Intergenic
941809620 2:169742625-169742647 CTTCAGATTAACCATCATATGGG - Intronic
941815222 2:169789429-169789451 TTTCTTTTTCACTCTCCTATTGG - Intergenic
942421449 2:175812316-175812338 CTCCAGTTTGACTTTCAAATGGG + Intergenic
942871000 2:180733785-180733807 GTTCAGTTTCACTGTCATAAAGG + Intergenic
943157409 2:184200843-184200865 CTTCATTATCACTCTTTTATTGG - Intergenic
943200664 2:184819562-184819584 CTCCAGCTTCACTCTGATCTTGG - Intronic
943350230 2:186788425-186788447 CTTCAGTTTTGCTCTGATCTAGG - Intergenic
944865465 2:203855704-203855726 CTAAAGTGTCACTCTTATATAGG + Intergenic
944941272 2:204630957-204630979 CTTCAGTTTAGCTCTGATCTTGG + Intronic
945524302 2:210869081-210869103 CTTCAGTTCCACTCTGAGCTTGG - Intergenic
946785953 2:223244504-223244526 CTTCAGTTTGGCTCTGATCTTGG + Intergenic
947283829 2:228487576-228487598 CTTCAGCATCACTATCACATAGG - Intergenic
1169525110 20:6416113-6416135 CTTTAGTTACACTCCCATAAAGG + Intergenic
1170766760 20:19296347-19296369 CTTCAGTTCCACTGTGATCTTGG + Intronic
1172314721 20:33944791-33944813 CTTGAGTTTCACTCCCGTGTAGG + Intergenic
1173226644 20:41166105-41166127 CTTGAGTTCCACCCTCATTTGGG + Intronic
1173261884 20:41443802-41443824 CTTCTGGTTCACTGTCATATTGG + Intronic
1177117894 21:17107622-17107644 CTTCAGTTCCACTCTAATCTTGG - Intergenic
950599820 3:14023636-14023658 CTTCAGTTCAACTCTTATTTTGG + Intronic
950995510 3:17492281-17492303 CTTCAGTCCCACTCTGATCTTGG + Intronic
951167224 3:19497243-19497265 CTTCAGTTTAGCTCTAATTTTGG + Intronic
951432577 3:22625513-22625535 CTTCAATTCCACTCTGATCTTGG + Intergenic
951910933 3:27749563-27749585 CTTCAGTTTGAGTCTCACTTTGG + Intergenic
953269535 3:41426909-41426931 CTTCAGTTCCACTCTGATCTTGG - Intronic
958523635 3:95224181-95224203 CTTCAGTTATACTCTCATCTTGG + Intergenic
958697110 3:97541975-97541997 CTTCAGTTTGCCACTCAGATTGG - Intronic
959139460 3:102468120-102468142 GTTCATTTTTACTCTCAAATAGG + Intronic
959256497 3:104021701-104021723 CTTCAGTTACACTCTGATCTTGG - Intergenic
959309874 3:104721323-104721345 ATACAGTTTAAATCTCATATTGG + Intergenic
959883244 3:111470879-111470901 CTTCAGTTCCACTCTGATCTTGG + Intronic
960276938 3:115739370-115739392 CTTCAGTTCTGCTCTCATCTTGG + Intergenic
960567807 3:119153834-119153856 CTTCAGTTTCACTCTGAGCTTGG + Intronic
960679814 3:120236001-120236023 CTTCAGTTCCACTCCAATCTTGG + Intronic
960919117 3:122728739-122728761 CTTCAGCTTCCCTTTCATAATGG + Exonic
960957745 3:123046159-123046181 CTTCGGTTTCTCTCTCATTGAGG - Intergenic
961007366 3:123413939-123413961 GTTCAGCCTCACTCTCAGATGGG + Intronic
961987116 3:131146980-131147002 CTTCCTTTTCACTCTCCTAATGG + Intronic
962983662 3:140514089-140514111 CTTCAGTTTCACTCTGATCTTGG + Intronic
963416000 3:144996366-144996388 CTTCAGTTTTGCTCTGATTTTGG + Intergenic
963422902 3:145084619-145084641 CTTCATTTTCTCTCTACTATTGG + Intergenic
963493560 3:146031585-146031607 CTTCAGTTCCACTCTAATCTTGG + Intergenic
963532331 3:146486310-146486332 CTTCAGTTCCACTCTGATCTTGG - Intronic
964581560 3:158245033-158245055 CTTCAGTTCCATTCTGATCTTGG + Intronic
965256569 3:166421460-166421482 CTTCAGTTCCACTCTGATTTTGG + Intergenic
965473979 3:169131240-169131262 CTTCAGCTTCACTGTAATAGTGG + Intronic
965806939 3:172551660-172551682 CTTCACTTTCACTCTGGTAGTGG + Intergenic
966981822 3:185143782-185143804 GTTCAGTTTCACTTTAACATAGG + Intronic
970333219 4:15004461-15004483 CCTCAGTTCCACTCTCACTTGGG - Intronic
970965002 4:21918201-21918223 TTTTAGTTTCACTCTGATGTAGG - Intronic
971270088 4:25135201-25135223 CTTCAGTTCCACTGTGATCTTGG - Intronic
971285735 4:25288105-25288127 CTTCAGTTCCAGTCTGATCTTGG + Intergenic
971429247 4:26546801-26546823 CTTCTGTTCCACTCTGATCTTGG + Intergenic
971919001 4:32912044-32912066 CTTCAGTTTGGCTCTGATCTTGG - Intergenic
972221010 4:36954363-36954385 CTTCAGTTACACTCTGATCATGG + Intergenic
972989861 4:44811605-44811627 CTTCAGTTTAGCTCTGATCTTGG + Intergenic
973105394 4:46329570-46329592 CTTCAGTTTCTTTCTGATTTTGG + Intronic
974184359 4:58427492-58427514 CTTCAGTTAAACTCTGATTTTGG + Intergenic
974899416 4:67978998-67979020 CTTCAGTTTTGCTCTGATCTTGG + Intergenic
976381691 4:84406809-84406831 TTTCACTTTCACTCTAATATTGG + Intergenic
976793065 4:88901744-88901766 CTTCAGTTCCACTCTGATACTGG - Intronic
976845078 4:89479596-89479618 CTTCAGTTCCACTTTGATCTTGG - Intergenic
977040080 4:92004787-92004809 CTTCAGTTCCACTCTGATCTTGG - Intergenic
977737438 4:100434018-100434040 CTTCAGTTCCACTCTGATCTTGG - Intronic
978025325 4:103866435-103866457 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
978054449 4:104246458-104246480 CTTCAGTTCCATTCTGATTTTGG + Intergenic
978288482 4:107108330-107108352 CTTCAATTGCACTCTGATCTTGG - Intronic
978596508 4:110382924-110382946 CTTCAGTTCAGCTCTCATTTTGG - Intronic
978771434 4:112460516-112460538 CTTCAGTTCAGCTCTCATTTTGG - Intergenic
978898532 4:113920798-113920820 CTTCATTTTTACTCTAAAATAGG - Intronic
979662865 4:123278451-123278473 CTTCAGTTCAGCTCTCATTTTGG + Intronic
979771242 4:124527086-124527108 CTGCTGTTTCAATCTCATCTGGG + Intergenic
980021840 4:127719978-127720000 CTTCATTTCCACTCTGATTTTGG + Exonic
980685070 4:136217114-136217136 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
981775039 4:148357028-148357050 CTTCAGTGACAATTTCATATAGG + Intronic
982750800 4:159158857-159158879 CTCAAGTTTCACTCTTATTTGGG + Intronic
983437949 4:167740019-167740041 CGCAAGTTTCACTTTCATATTGG - Intergenic
983774637 4:171592054-171592076 CTTCAGTTCCACTCTGATCTTGG + Intergenic
983958022 4:173719638-173719660 CTTCAGTTCCTCTCTGATTTTGG - Intergenic
983972098 4:173888057-173888079 CTTCAGTTCCGCTCTGATCTTGG + Intergenic
984555542 4:181209884-181209906 TGTCACTTTCACTCTCATTTGGG + Intergenic
984913781 4:184701366-184701388 TTTCAGTTTTAATCTCTTATTGG - Intronic
987644531 5:20651240-20651262 CTTCAGTTCAACTCTGATTTTGG - Intergenic
987852852 5:23379531-23379553 CTTCATTTCCACTCTGATCTTGG - Intergenic
987915099 5:24202538-24202560 CTTCAGTTCCACTCTGATTTTGG - Intergenic
988875872 5:35444923-35444945 CTTCTGGTTCCCTCTCATTTGGG - Intergenic
989505802 5:42226088-42226110 CTTCAGTTTGGCTCTGATTTTGG + Intergenic
989693592 5:44173144-44173166 CTTCAGTTTAGCTCTGATTTTGG - Intergenic
990705014 5:58518259-58518281 CTTCAGTTCAACTCTGATCTTGG - Intergenic
990940441 5:61197815-61197837 CTTCAGTGCCACTCTGATCTTGG + Intergenic
991526467 5:67564294-67564316 CTTCAGTTCAACTCTGATTTTGG - Intergenic
992805654 5:80335029-80335051 CTTCAGTTACCCTATCAAATGGG - Intergenic
993089767 5:83410908-83410930 CTTCAGTTCCACTCTGATCTTGG - Intergenic
993743975 5:91573527-91573549 CTTCAGTGTTACTCTCTCATAGG - Intergenic
994137674 5:96306447-96306469 CTTCAGTTTTGCTCTGATCTTGG + Intergenic
994443919 5:99847655-99847677 CTTCAGTTTCACTTTCCTGATGG + Intergenic
995052519 5:107722386-107722408 CTTTAGTTCCACTCTGATCTTGG - Intergenic
996451609 5:123631879-123631901 CTTCAGTTCAACTCTGATTTTGG - Intergenic
996830030 5:127730014-127730036 CTTCAGTTCCACTTTGATTTTGG - Intergenic
997781069 5:136659058-136659080 ATCCAGATTCACTCTTATATGGG + Intergenic
998275621 5:140750440-140750462 CTTCAGTTCAACTCTGATTTTGG + Intergenic
998480604 5:142459570-142459592 CCTCAGCTTCACTCTGAAATTGG + Intergenic
1000869707 5:166560551-166560573 CATCAGTTTCACACTCCTTTCGG - Intergenic
1003294634 6:4814356-4814378 GTTCAGTTTCACTTTCTAATAGG - Intronic
1004983784 6:21057518-21057540 CTTCAGTTCCACTCTGAGCTTGG + Intronic
1006240803 6:32676822-32676844 CTTCAGTTCCAGTCTGATTTTGG + Intergenic
1006712468 6:36086297-36086319 CTTCAGTTCCACTCTGATCTTGG - Intronic
1006978982 6:38131294-38131316 ATTTAGTTTTACTCTGATATTGG + Intronic
1007133980 6:39503467-39503489 CTTCAGTTCAGCTCTGATATTGG - Intronic
1007522571 6:42462836-42462858 CTACAGTTTCATTCTCTTAACGG + Intergenic
1008208414 6:48690605-48690627 CTTCAGTTCAGCTCTCATTTTGG - Intergenic
1008823541 6:55663183-55663205 CTTCAGTTCCGCTCTGATTTTGG + Intergenic
1009783024 6:68294504-68294526 CTTCAGTTTAGCTCTGATCTTGG + Intergenic
1010500985 6:76600100-76600122 CTTCAGTTCCATTCTGATCTTGG - Intergenic
1010555934 6:77279646-77279668 CTTCAGTTTATCTCTGATTTTGG - Intergenic
1010865071 6:80966293-80966315 TTTCAGTTTCTCTTTCAAATAGG - Intergenic
1011167094 6:84461006-84461028 CTTCAGTGACAATCTCATAATGG + Intergenic
1011377358 6:86704007-86704029 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1012104259 6:95134084-95134106 CTGCAGTTTCACAGGCATATTGG - Intergenic
1012232035 6:96771235-96771257 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1012606248 6:101161326-101161348 CTTCATTATTACTTTCATATGGG - Intergenic
1013388367 6:109656017-109656039 CTTTAGTTTCTCTATCATATGGG + Intronic
1013919809 6:115390628-115390650 CATCAGTTCCACTCTGATCTTGG + Intergenic
1014564103 6:122927586-122927608 CTTCAGTTTTGCTCTGATCTTGG + Intergenic
1015368298 6:132422545-132422567 CTTCAGTTCCACTCTGATTTTGG + Intergenic
1015447851 6:133327932-133327954 CGTCAGTGTCACTTTCATATGGG + Intronic
1016910030 6:149189891-149189913 CTTCTGGTTCCTTCTCATATGGG + Intergenic
1017957698 6:159192636-159192658 GTTCAGTTTGAAACTCATATTGG + Intronic
1020393530 7:7686686-7686708 CTTTAGCTTCACTGTGATATGGG + Intronic
1020599217 7:10250975-10250997 CTTCACTTTCACTCTGAGGTTGG - Intergenic
1020619422 7:10499912-10499934 TTTCAGTTTCACTCTGATCTTGG - Intergenic
1021390901 7:20091583-20091605 CTTCAGTTCCACTCTGAGCTTGG - Intergenic
1022798048 7:33748625-33748647 CCTCAGTTTCAGCCTCATAGTGG + Intergenic
1022849193 7:34242689-34242711 CATAATTTTCACTCTCATAAAGG + Intergenic
1023034304 7:36117312-36117334 CTTCAGTGTCACTGTCCTGTTGG + Intergenic
1023195937 7:37639297-37639319 CTTCAGTTCTGCTCTGATATTGG + Intergenic
1023317886 7:38959215-38959237 CTTTAGTTCCACTCTGATTTTGG - Intergenic
1023652818 7:42389209-42389231 CTTCAGCTTCACTGTCACCTTGG + Intergenic
1023657881 7:42444320-42444342 ATTCAGTTTAACTCTGATTTTGG + Intergenic
1024034093 7:45492453-45492475 CTTCAGTTCTGCTCTCATTTTGG + Intergenic
1025856319 7:65282827-65282849 CTTCAGTTTGGCTCTGATCTTGG - Intergenic
1027573046 7:79895887-79895909 TTTCATTTTCACTCTAAAATGGG + Intergenic
1027627188 7:80560930-80560952 CTTCAGTTTAACTCTGATTTTGG + Intronic
1028027914 7:85869570-85869592 CTTCAGTTCCACTCACATCTTGG - Intergenic
1028183621 7:87754579-87754601 CTTCAGTTTAGCTCTGATTTTGG - Intronic
1028523288 7:91755579-91755601 CTTCAGTTCCACTCTGATCTTGG - Intronic
1030363254 7:108617768-108617790 TTTCAGTTTCATTCTCATTTTGG + Intergenic
1030988903 7:116276192-116276214 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1031951406 7:127896236-127896258 CTTCCGTCTCACTCTCCTCTTGG + Intronic
1033139170 7:138809495-138809517 CTTGAGTTTTACACTCACATGGG - Intronic
1033976902 7:147113812-147113834 CTTCAGTTTAGCTCTGATCTTGG + Intronic
1037001753 8:13728182-13728204 CCTCGGTTTCACTCTCATATGGG - Intergenic
1039102419 8:33955061-33955083 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1039289542 8:36079030-36079052 CTTCAGTTCAACTCTGATTTGGG - Intergenic
1041341353 8:56849403-56849425 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1041544912 8:59032148-59032170 CTTCTCCTTCACTCCCATATTGG - Intronic
1043092839 8:75927011-75927033 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1043222473 8:77684603-77684625 TTTCAGTTTCATTCTGATTTTGG + Intergenic
1043324838 8:79037050-79037072 CTTCAGTTTAGCTCTGATCTTGG - Intergenic
1043496075 8:80801816-80801838 CTTCAGTTCAACTCTGATCTTGG - Intronic
1044116930 8:88347218-88347240 CTTCAGTTTTGCTCTGATCTTGG + Intergenic
1044127994 8:88482314-88482336 CTTCAGTTCAGCTCTCATTTTGG - Intergenic
1044222133 8:89681497-89681519 CTTCAGTTCCTCTCTGATCTTGG - Intergenic
1044357852 8:91245504-91245526 CTTCGTTTTCCCTCTCAGATGGG + Intronic
1044418076 8:91958870-91958892 CTGCTATTTCACTCTCTTATAGG - Intronic
1045164280 8:99585989-99586011 GTAGAGTTTCACTCTCATGTGGG - Intronic
1045978101 8:108152188-108152210 ATTCAGTTCCACTCTGATCTTGG - Intergenic
1046596700 8:116269864-116269886 CTTCAGTTTAGCTCTGATATTGG + Intergenic
1046987141 8:120400612-120400634 CTTCAGTTCTACTCTGATCTTGG - Intronic
1047080073 8:121450194-121450216 CTTCAAGTTCATTCCCATATAGG + Intergenic
1047300206 8:123607515-123607537 CTTCAGTTCCGCTCTGATCTTGG - Intergenic
1047392747 8:124466650-124466672 CTTCAGTTTCACCTTCAAAAGGG - Intergenic
1048626153 8:136187601-136187623 TTTCAGTCTCAGTTTCATATAGG + Intergenic
1048963951 8:139601690-139601712 CTCCAGTTTCACCCTCATTCAGG - Intronic
1050390981 9:5144000-5144022 CTTCAGTTTAGCTCTGATTTTGG + Intronic
1050398400 9:5224864-5224886 CTTCAGTTTGACTCTGATCTTGG - Intergenic
1050611559 9:7359250-7359272 CTTCAGAATCAGTCTCATTTGGG + Intergenic
1050817647 9:9835519-9835541 CTCCAGTTTAATTCTCATTTGGG - Intronic
1051115970 9:13694876-13694898 CTTCAGTTCAGCTCTCATTTTGG + Intergenic
1051313669 9:15805241-15805263 CTTCAGTTAAACTCTGATCTTGG + Intronic
1051547647 9:18294280-18294302 CTTCAGGTTTCCTCTAATATTGG + Intergenic
1051946415 9:22574605-22574627 CTTCAGTTCCACTCTGAAATTGG - Intergenic
1055234368 9:74102494-74102516 CTTCAATTCCACTCTGATCTTGG - Intergenic
1055789305 9:79904931-79904953 CTTCTTTGTCACTCTCATTTTGG - Intergenic
1056774534 9:89501312-89501334 CTTGAGTTTTTTTCTCATATGGG - Intergenic
1057402964 9:94740864-94740886 CTTCACTGTAACTCTGATATGGG - Intronic
1057783729 9:98071475-98071497 CTTCACTTTCCCTCCCAGATGGG - Intronic
1058605647 9:106719869-106719891 CTTCAGATTCAGACTTATATTGG - Intergenic
1059865310 9:118507673-118507695 CTTCAGTTCTGCTCTCATCTCGG - Intergenic
1060626703 9:125119889-125119911 CTTCAGTTTCCCTCTTACACAGG + Intronic
1203497780 Un_GL000224v1:168788-168810 GTTCTGTTTCACCCTCACATAGG - Intergenic
1203510331 Un_KI270741v1:111038-111060 GTTCTGTTTCACCCTCACATAGG - Intergenic
1185803388 X:3033553-3033575 CTCCAGGTTCACTGTTATATGGG - Exonic
1186234652 X:7494430-7494452 CATCAGATTCACTCTCAAAAAGG - Intergenic
1187605478 X:20877717-20877739 CTTCAGTTCCACTCTGAGCTTGG - Intergenic
1187818472 X:23259047-23259069 CTTCAGTTCCACTCCGATCTTGG - Intergenic
1189939166 X:46103602-46103624 CTTCAGTTGCACTCTGATCTTGG + Intergenic
1190729838 X:53218375-53218397 GTTCAGTTTCACTCTCGTCTGGG + Exonic
1190972091 X:55359609-55359631 CTTCAGTTTCACTCTAATCTTGG - Intergenic
1190992820 X:55569666-55569688 CTTCAGTTTCACTCTGAGTTTGG - Intergenic
1191037400 X:56041546-56041568 CTTCAGTTTAGCTCTGATCTTGG + Intergenic
1191064573 X:56334166-56334188 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1191132351 X:57028038-57028060 CTTCAGTTTTACTCTGAACTTGG + Intergenic
1191171510 X:57452276-57452298 CTTGAGTTTCACTCTAATGCTGG - Intronic
1191815347 X:65238585-65238607 CTTCAATTCCACTCTGATCTTGG + Intergenic
1191821875 X:65319073-65319095 CTTGAGTTCCACTCTGATTTTGG - Intergenic
1192539026 X:71952749-71952771 CTTCAGTTTCACCTTCCTGTTGG + Intergenic
1192702614 X:73491673-73491695 CTTCAGTTTGGCTCTAATCTTGG + Intergenic
1192881008 X:75284398-75284420 TTTCTGTTTCATTCTCATTTGGG + Intronic
1192934278 X:75842728-75842750 CTTCAGTTCCACTATGATTTTGG + Intergenic
1192960908 X:76129920-76129942 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1193028966 X:76877849-76877871 CTTCAGTTTAGCTCTAATTTTGG - Intergenic
1193190093 X:78560800-78560822 CTTCAGTTCCACTCTGAGCTTGG + Intergenic
1193528371 X:82621718-82621740 CTTCAGTTCAGCTCTGATATTGG - Intergenic
1193530469 X:82649009-82649031 CTGCAGTTTCATTCTAATATTGG + Intergenic
1193899123 X:87153781-87153803 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1194070693 X:89322138-89322160 CTTCAGTTTAACTGTTATGTTGG - Intergenic
1194154192 X:90366161-90366183 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1194344622 X:92748191-92748213 CTTCAGTTTACTTCTCATTTTGG + Intergenic
1194406083 X:93497246-93497268 CTTCAGTTCCACTCTGAGCTTGG - Intergenic
1194506149 X:94736162-94736184 CTTCAGTTTAGCTCTTATTTTGG + Intergenic
1194517767 X:94877811-94877833 CTTCAGTTCCACTCTGATTTTGG - Intergenic
1194774993 X:97952405-97952427 CTTCAGTTCCACTCTGATTTTGG - Intergenic
1194790845 X:98147524-98147546 CTTCAATTCCACTCTGATCTTGG - Intergenic
1195153712 X:102100391-102100413 CTTCAGTTACACTCTGATCTTGG - Intergenic
1195155491 X:102118894-102118916 CTTCAGTTGCACTCTGATTTTGG - Intergenic
1195212824 X:102666852-102666874 CTTCAGTTTTGCTCTCATCTTGG + Intergenic
1195213921 X:102677765-102677787 CTTCAGTTCAACTCTGATCTTGG + Intergenic
1195931810 X:110085553-110085575 GCTCAGATTCTCTCTCATATTGG + Intronic
1196168248 X:112558537-112558559 CTTAAGTTCCACTCAGATATTGG - Intergenic
1196234067 X:113258888-113258910 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1197077454 X:122369660-122369682 CTTGCTTTTCACTCTCTTATGGG - Intergenic
1197406736 X:126063126-126063148 CTTCAGTTCAGCTCTCATTTTGG - Intergenic
1197423772 X:126270318-126270340 CTTCATTTTCACTCTGATCTTGG + Intergenic
1197512201 X:127383589-127383611 CTTCAGTTCAGCTCTCATTTTGG + Intergenic
1197522974 X:127522640-127522662 CTTCAGTTTTGCTCTGATCTTGG - Intergenic
1198796307 X:140399673-140399695 CTTCAGTTCCACTCTGATCTTGG - Intergenic
1199232992 X:145461138-145461160 CTGAAGTTTCATCCTCATATTGG - Intergenic
1199307955 X:146289894-146289916 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1199589089 X:149449470-149449492 CTTCAGTTCAACTCTAATCTTGG + Intergenic
1200321268 X:155192671-155192693 CTTCAGTTCCACTCTGATCTTGG + Intergenic
1200500547 Y:3943054-3943076 CTTCAGTTTAGCTCTGATTTTGG + Intergenic
1200571070 Y:4830191-4830213 CTTCAGTTCCACTCTGAGCTTGG - Intergenic
1200652969 Y:5864829-5864851 CTTCAGTTTACTTCTCATTTTGG + Intergenic
1200724929 Y:6657884-6657906 CTTCAGTTTAACTGTTATGTTGG - Intergenic
1202347728 Y:23952418-23952440 CTTTATTTTCTCTCTCAAATAGG - Intergenic
1202523044 Y:25717673-25717695 CTTTATTTTCTCTCTCAAATAGG + Intergenic