ID: 1124090213

View in Genome Browser
Species Human (GRCh38)
Location 15:26592330-26592352
Sequence CAAGATCACCACATCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090210_1124090213 18 Left 1124090210 15:26592289-26592311 CCTAGAGGCTACAGCCTCCAATA 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1124090211_1124090213 4 Left 1124090211 15:26592303-26592325 CCTCCAATATGAGAGTGAAACTG 0: 1
1: 0
2: 0
3: 9
4: 217
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1124090212_1124090213 1 Left 1124090212 15:26592306-26592328 CCAATATGAGAGTGAAACTGAAG 0: 1
1: 0
2: 5
3: 86
4: 342
Right 1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090213 Original CRISPR CAAGATCACCACATCCATAT TGG Intronic
905949997 1:41942217-41942239 CACAATTAACACATCCATATGGG + Intronic
906837576 1:49100493-49100515 CAAGATCACCAAATCCGGACTGG + Intronic
906944811 1:50286619-50286641 CAAGCTCACCACAACCCTTTAGG - Intergenic
908495452 1:64689746-64689768 CAGGATGACCACAGCCATAGAGG - Intronic
911564881 1:99452168-99452190 CATGCTCACCACATCTCTATTGG - Intergenic
916754506 1:167756115-167756137 CAAGATTACCAAATCCCTCTCGG - Intronic
922038826 1:221875852-221875874 GAACATTACTACATCCATATAGG + Intergenic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1065667438 10:28077243-28077265 CAAGCTCACGACACCCATGTAGG + Intronic
1066990202 10:42505900-42505922 CAGGATCTTCACCTCCATATAGG - Intergenic
1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG + Intergenic
1070410147 10:76132219-76132241 CAAAATCACCACCTCTATTTTGG - Intronic
1071286523 10:84152986-84153008 AAACATGACCACATCTATATTGG - Exonic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1080722661 11:34865219-34865241 CAATACCACCACATTCATTTGGG + Intronic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1100734780 12:97514252-97514274 CCAGATGACAACATCCTTATGGG + Intergenic
1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG + Intronic
1103316044 12:120056771-120056793 CCAGGTCTCCACATCCATCTAGG - Intronic
1106127016 13:26909004-26909026 CAAGAGCACCACAGCCAGAATGG + Intergenic
1109197980 13:59400145-59400167 CAAGATTACCATTGCCATATTGG + Intergenic
1109208791 13:59511122-59511144 CAAGATCACCAGATTCACAGTGG + Intergenic
1110642915 13:77847091-77847113 CAAGATCAGCAATTTCATATAGG + Intergenic
1111140334 13:84109785-84109807 CAAGATCAACACATCAAACTAGG - Intergenic
1113821236 13:113214957-113214979 CAAGATGTCCACAGCCACATGGG - Intronic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1116610309 14:47061512-47061534 AAAGATGACAACATCCAGATTGG - Exonic
1121778522 14:96606832-96606854 CAAGGAGACCACATCCACATGGG - Intergenic
1122098229 14:99386856-99386878 CCAGATCAGCCCATCCATTTGGG + Intergenic
1123693552 15:22859693-22859715 CAAGATCCAGACATCAATATGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1127041686 15:54984019-54984041 CCAGATCACCAAATCCAAAGTGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1130099127 15:80878780-80878802 CAAGACCACCATGTGCATATCGG + Exonic
1130263093 15:82374990-82375012 TAAGTTCACCACATCCCTTTAGG + Intergenic
1131018216 15:89075345-89075367 CAAGCTCACTCCATCCATAAAGG - Intergenic
1142041351 16:87896467-87896489 GAGGATCACCACATGCATAAAGG - Intronic
1144385285 17:14743903-14743925 GAAGATCAACACATCCAACTGGG - Intergenic
1151536897 17:74744336-74744358 CATGATCACCACGTCCCTCTGGG - Exonic
1153212331 18:2780769-2780791 CCTGAACACCACATTCATATAGG - Intronic
1156617401 18:38803663-38803685 TATGATCACCACAGCCATCTGGG + Intergenic
1157065447 18:44343787-44343809 CAAGATAACCACACTCATTTTGG - Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1165568029 19:36749118-36749140 CAACATCAACAAATCCATACTGG - Exonic
925292731 2:2758587-2758609 CAAGTTCATCAAATCCAAATTGG - Intergenic
926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG + Intergenic
931277035 2:60753183-60753205 ACAGATCATCACATACATATTGG + Intergenic
934542572 2:95188263-95188285 CAAGAACACCAGGTCCACATGGG + Intergenic
937271874 2:120658108-120658130 CAAGTTGAGCCCATCCATATTGG - Intergenic
939442894 2:142272771-142272793 CAAGGTAACCACATCAATGTGGG + Intergenic
945227522 2:207547266-207547288 CAAAATCACTACATCCAAATGGG - Intronic
945630101 2:212263976-212263998 CAACATGACCACAGCAATATAGG - Intronic
946228490 2:218277509-218277531 CAAAATCACCACTTCCAGAGGGG + Intronic
946612004 2:221468868-221468890 CAAGATGACAACAACCATAGTGG - Intronic
1172550361 20:35794331-35794353 CAAGATAAGCACATACATAAGGG - Intronic
1180100406 21:45581342-45581364 CATGATCTCCTCATCCACATGGG - Intergenic
1181323007 22:22023072-22023094 GAAGAACACAAGATCCATATGGG + Intergenic
1184326427 22:43790983-43791005 GAAGATCAACACTTCCATTTTGG + Intronic
968550730 4:1222390-1222412 CAAGATCACCACAGACAGAGGGG + Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
970126294 4:12815961-12815983 CAAGTACACCCCATCCATAGAGG + Intergenic
970587033 4:17523991-17524013 AAATCTCACCACATCCCTATGGG + Intronic
976724443 4:88202072-88202094 CAAGATCACAAAATGAATATCGG + Intronic
981001547 4:139833563-139833585 CAAGATCATCACAACCCTAGTGG + Intronic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
989035781 5:37170184-37170206 CAACATCACCACATCCTCTTAGG + Exonic
991633868 5:68683502-68683524 CAAGATCATCCCATCCATCCTGG - Intergenic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
998680115 5:144457693-144457715 CAATATCACAACATATATATTGG - Intronic
1003460432 6:6323407-6323429 CAAGATACCCTCATCCATGTGGG + Intergenic
1008024792 6:46623068-46623090 CAAGATCACCATTTCCTTCTTGG - Intronic
1009426252 6:63516849-63516871 CAAGGTCACCTCATCCACAGAGG - Intergenic
1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG + Intergenic
1015976027 6:138791710-138791732 CAAGCTGACCACTTCCATAAAGG + Intronic
1023699772 7:42881693-42881715 CAAGATGAACTCAGCCATATTGG - Intergenic
1024458797 7:49638489-49638511 CATGAGCAGCACAGCCATATAGG - Intergenic
1028944972 7:96569154-96569176 TAATATCATCACATCCTTATTGG - Intronic
1029498772 7:100914557-100914579 GTAGATCACCACATCCACATGGG + Intergenic
1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG + Intronic
1034103786 7:148473360-148473382 CAAGTTCATCACATCCCTTTGGG + Intergenic
1051286880 9:15506705-15506727 CAAGAGCACAACATCCAAAAGGG + Intronic
1055978080 9:81973785-81973807 CAAGATCACCTTCTCCAAATAGG - Intergenic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1057937899 9:99256336-99256358 CAATATCACCACATCCCTGGAGG - Intergenic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1060507203 9:124206962-124206984 CAAAATCACCAAATACACATCGG - Intergenic
1061026332 9:128052106-128052128 CAAGGTCACAGCACCCATATGGG + Intergenic
1188120671 X:26303295-26303317 TAAAATCACCACTTCCTTATGGG - Intergenic
1193987223 X:88258571-88258593 CAGGATAAACACATCAATATAGG - Intergenic
1202015056 Y:20396301-20396323 CAACATCAAAAAATCCATATAGG + Intergenic