ID: 1124090518

View in Genome Browser
Species Human (GRCh38)
Location 15:26595644-26595666
Sequence GGGTTGCTTTAGGCTCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090518_1124090526 29 Left 1124090518 15:26595644-26595666 CCAAGTGGAGCCTAAAGCAACCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1124090526 15:26595696-26595718 TTCTGATTAACCCCTGTTCCAGG 0: 5
1: 30
2: 87
3: 91
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090518 Original CRISPR GGGTTGCTTTAGGCTCCACT TGG (reversed) Intronic
902557672 1:17256521-17256543 GGGGTGCTTCAGTCTTCACTGGG + Intronic
903226581 1:21897192-21897214 GGGTTCCCTTGGGCTCCCCTGGG - Intronic
903510724 1:23873170-23873192 TGGCTGTTTTAGGCTCCTCTGGG + Exonic
905772982 1:40650184-40650206 AGGTTCCTGAAGGCTCCACTAGG + Intronic
908566627 1:65363573-65363595 GGGGTGATTTTGCCTCCACTAGG + Intronic
910414791 1:86986323-86986345 GGGCTGCATTAAGTTCCACTAGG + Intronic
912333639 1:108842808-108842830 GGGTTTTCTTAGGCTCCTCTGGG + Intronic
919536250 1:198791322-198791344 TGTTTGCTTTAGGCCCCAATAGG - Intergenic
919734441 1:200936965-200936987 GGGTTGCTTCAGGCCCCATAGGG + Intergenic
921013181 1:211162433-211162455 GGGTAGCTGGAGGCCCCACTTGG + Intergenic
923189164 1:231603765-231603787 GAGTTAATTCAGGCTCCACTAGG + Intronic
924677751 1:246197608-246197630 GTGTTGCTTTAGGCTTCTCTTGG - Intronic
1067774355 10:49151718-49151740 GCATTGCCTTAGGCTCCTCTTGG - Intergenic
1069633546 10:69912107-69912129 GGGTCGCTTTAGTCTCCACAAGG - Intronic
1072221515 10:93331386-93331408 GGGGTGCTGTAGGCTCTGCTCGG - Intronic
1073186911 10:101620518-101620540 GGGTTGCCCTGGGCACCACTTGG - Intronic
1074261436 10:111857423-111857445 GGCCTCCTTTAGGCTCCTCTTGG + Intergenic
1075258001 10:120940328-120940350 GGATTGCTTTAAGCAACACTGGG - Intergenic
1076627612 10:131831667-131831689 GGCTTGCTCTTGGCTCCACCAGG - Intergenic
1077390505 11:2298793-2298815 GGGTCCCTTTAGACTCCCCTGGG + Intronic
1077821042 11:5740779-5740801 GGCTTACTGTACGCTCCACTAGG - Intronic
1078423426 11:11230513-11230535 TTGTTGATTTAGGCTCCACATGG - Intergenic
1081612948 11:44574072-44574094 GGGTTGCTTGAAGCTCTGCTGGG + Intronic
1086915575 11:92526409-92526431 GGGGTATTTCAGGCTCCACTGGG - Intronic
1088876207 11:113938692-113938714 GAGTTTATTTAGGCTGCACTGGG + Intronic
1089374416 11:117984455-117984477 GAGTTGCTTTAGCCTCCATAAGG - Intergenic
1091330437 11:134727705-134727727 GGGTTGCCTTGGGCTCCAGCAGG - Intergenic
1100202007 12:92309010-92309032 ATGTCGCTTTAGGCTCCTCTTGG + Intergenic
1100692955 12:97058454-97058476 GGGTGGCCCTAGGATCCACTGGG - Intergenic
1101599567 12:106197444-106197466 GTGTTTCTTTAGGCTCCTCTGGG + Intergenic
1101864251 12:108508347-108508369 GGGAGGATGTAGGCTCCACTGGG + Intergenic
1104124788 12:125835994-125836016 GGGTCTCCTTAGGCTCCTCTTGG + Intergenic
1105619944 13:22057053-22057075 ACGTTGCTTTAGGCTCCTCTGGG + Intergenic
1106998322 13:35514309-35514331 GGGTTCTGTTAGGCCCCACTAGG - Intronic
1107552596 13:41491292-41491314 TGCATGCTATAGGCTCCACTTGG + Intergenic
1111351393 13:87036067-87036089 AGGTTTCTTTAGGGTCCCCTTGG - Intergenic
1119036058 14:71231321-71231343 GGGTGGCTTCAGGCTGCACCCGG - Intergenic
1119443793 14:74647369-74647391 GGGTTGCCTGAGGCCCCACAGGG - Intergenic
1121399671 14:93662461-93662483 GGGTTGCTACAGGAGCCACTGGG + Intronic
1121871471 14:97411977-97411999 GGGAAGCTGTAGGCTGCACTGGG + Intergenic
1122537462 14:102475576-102475598 GTCTTGCTTTAAGCTCCAGTAGG - Intronic
1122567033 14:102666580-102666602 TTGTTGCTTTAGGTTCCTCTTGG + Intronic
1124090518 15:26595644-26595666 GGGTTGCTTTAGGCTCCACTTGG - Intronic
1127446093 15:59064902-59064924 GGGGTGCTTCAGGCTCTGCTTGG - Intronic
1129351002 15:74956056-74956078 GGGTTCCCCTAGGCTCCTCTTGG + Exonic
1131232906 15:90672413-90672435 AGGTTGCTTTAGACTCCCATAGG - Intergenic
1134486891 16:14665804-14665826 GAGTTGCTTTGGCCTCCACAGGG + Intronic
1134909960 16:18016544-18016566 GTGTTGCTTTAACCTCTACTGGG - Intergenic
1147839786 17:43363118-43363140 TGGCTGCTTTAGGTTTCACTTGG - Intergenic
1148085733 17:44992818-44992840 GTGCTGCTTTGGGCTCCCCTAGG - Intergenic
1151101496 17:71561275-71561297 AGGTAACTTAAGGCTCCACTTGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1158402139 18:57130866-57130888 GGGTTGCTATCAGCTACACTGGG + Intergenic
1159021207 18:63144746-63144768 GGCTTGCTTTAGGACCCACCAGG - Intronic
1161321029 19:3641636-3641658 GGGGTGCTCTTGGCTCCTCTGGG + Intronic
1167514630 19:49915921-49915943 GGGATGGTGTCGGCTCCACTGGG + Intronic
926769717 2:16359246-16359268 TGGTGGCTTTAGTCTCCATTGGG + Intergenic
933057473 2:77690269-77690291 GGGGTGCTTAAGACTCCAATAGG - Intergenic
935322100 2:101898985-101899007 TGGTTGCTGTAGGGTTCACTGGG - Intergenic
938745539 2:134274799-134274821 GGGTTGCTGTAAGTTCAACTTGG - Intronic
944646234 2:201783409-201783431 GGTTTTCTTTAGGATCCCCTTGG + Intergenic
947226145 2:227842261-227842283 GGTTTTCTTTAGGATCCCCTTGG + Intergenic
1169438443 20:5613791-5613813 GGGGTTCTTTTGGCTCCCCTGGG + Intergenic
1170044797 20:12073560-12073582 TGTTAGCTTGAGGCTCCACTAGG - Intergenic
1177247198 21:18543290-18543312 GAGTTGCTTTAGCCTCCACAAGG - Intergenic
1179621029 21:42616607-42616629 AGGTTGCCTGAGGCTCCAGTAGG - Intergenic
1179629621 21:42668290-42668312 GGGTTGCATTAGCTCCCACTCGG + Intronic
1182295110 22:29307709-29307731 GGGTTCCTTTCGTGTCCACTGGG + Intronic
951396422 3:22173198-22173220 GTATTTCTTTAGGCTCCACTGGG - Intronic
952212139 3:31238761-31238783 GGACTGATTTAGGCACCACTTGG + Intergenic
953366568 3:42350647-42350669 GGGTTGTTTGAGGACCCACTTGG - Intergenic
954216368 3:49126615-49126637 GGGTTGCGTTGGGCTGCGCTAGG + Intronic
957369764 3:79278342-79278364 GGGTTGCTTTTGGCTATTCTGGG - Intronic
960032929 3:113072940-113072962 AGGTTCCTTTTGGCTCCACCGGG - Intergenic
964367248 3:155963558-155963580 TGGCTGCTTTAGGCTGCACCAGG + Intergenic
968492876 4:899893-899915 TGGTGGCCTTAGGCTTCACTGGG - Intronic
969346310 4:6572545-6572567 GGGTTTCTTTGGGGTCCCCTTGG - Intergenic
971062897 4:22992500-22992522 GGTTTGCCTGAGGCTTCACTTGG + Intergenic
972502562 4:39692084-39692106 GAGCTGCTTTAGTCTCCACTAGG + Intergenic
973539422 4:51921528-51921550 AAGCTGCTTTTGGCTCCACTAGG + Intergenic
973736289 4:53874771-53874793 GGGTGGATGTATGCTCCACTGGG + Intronic
976073735 4:81272883-81272905 GGGTTGCTTTAGGGACCTATAGG - Intergenic
977819731 4:101458107-101458129 GGGTGGCTGGAGGCTCCAGTTGG - Intronic
983170051 4:164525612-164525634 GAGTTGCTTTGGCCTCCACATGG - Intergenic
984713155 4:182902823-182902845 GTGTTGCTTTAGCTTGCACTCGG - Intronic
987615138 5:20263705-20263727 AGGTAGCTTTAGGTTCCATTTGG + Intronic
988824105 5:34917209-34917231 GGATTGCATTAGGCTTCATTTGG + Intronic
989601984 5:43208887-43208909 GTGTTGGTTTTGGCTCCCCTAGG + Intronic
990445494 5:55890179-55890201 GGGCTGCTTTGGGCTAGACTTGG + Intronic
991166318 5:63567981-63568003 GGGTTTCTTTGAGGTCCACTCGG - Intergenic
991639837 5:68741192-68741214 GGGTTGCTATAGGATGCACTGGG - Intergenic
993001717 5:82387793-82387815 GGATTGGTTTAGTTTCCACTAGG + Intergenic
993945523 5:94113083-94113105 TGGTCTCTTTAGGCTCCTCTTGG - Intergenic
995405324 5:111788171-111788193 GGGTTGCATTACAATCCACTGGG - Intronic
1000118042 5:158171547-158171569 GGGTTCCTCTATGCTCTACTTGG - Intergenic
1001890074 5:175331442-175331464 CGGTTGGTTTAGTCTCCACAGGG - Intergenic
1003304654 6:4915439-4915461 AGGTTTCTTTAGGGTCCCCTTGG - Intronic
1003411518 6:5867401-5867423 GGTTTGCCTTAGGCTCCTCCAGG + Intergenic
1004181182 6:13381727-13381749 GGCTTGCTTTGTGCTCCAGTGGG + Intronic
1007585774 6:42988366-42988388 GGGGAGCTTTCGGCTTCACTAGG + Intronic
1009289796 6:61868397-61868419 CGGTGGCTGTAGGCTCCAGTTGG + Intronic
1010730027 6:79381320-79381342 GGCTTGCTTTGGGCCCCATTTGG + Intergenic
1010779281 6:79925965-79925987 GGGTTACTTTAGAATCCAGTTGG + Intronic
1014241825 6:119026521-119026543 AGGTTTCTTTGGGGTCCACTTGG - Intronic
1021333756 7:19372459-19372481 CTGTTTCCTTAGGCTCCACTTGG + Intergenic
1021978551 7:26032053-26032075 GGGTTGCTTAGTGCTTCACTTGG - Intergenic
1023715292 7:43037726-43037748 GGGTTGCTCTAGGCAACACATGG - Intergenic
1024018645 7:45344371-45344393 AGGTGGCTTTAGGCTCCTCCTGG - Intergenic
1024659614 7:51480648-51480670 GGTTTGCTGTCGGATCCACTTGG + Intergenic
1028085354 7:86629775-86629797 GTGTTTCTTTAGGCTCCTCTTGG + Intergenic
1030269433 7:107654564-107654586 CTGTTTCCTTAGGCTCCACTTGG - Intergenic
1031013177 7:116545210-116545232 GGGATGCTTCTGGCTCAACTTGG + Intronic
1031567058 7:123313322-123313344 TAGTTGCTTTAAACTCCACTTGG + Intergenic
1032705972 7:134421683-134421705 CGGTTATGTTAGGCTCCACTGGG + Intergenic
1033294560 7:140119586-140119608 AGTTTTATTTAGGCTCCACTAGG + Intronic
1037481751 8:19312596-19312618 GGGGTGCTTTAGGCTGGAGTGGG - Intergenic
1037598775 8:20376081-20376103 GGGATGCTTCAGGCTCCTCAGGG + Intergenic
1039436865 8:37565420-37565442 GGGGTGATTTAGGATCCACCTGG + Intergenic
1041761549 8:61372674-61372696 ATGTTTCTTTAGGCTCCTCTTGG + Intronic
1042029632 8:64462013-64462035 GGGTTGTTTTAGGCTTTATTGGG + Intergenic
1043990269 8:86744476-86744498 GGGTTGACTTAGGCTGCCCTGGG - Intergenic
1048570660 8:135652671-135652693 GGGATGCTTCAAGCTCCACTGGG - Intronic
1056526916 9:87451941-87451963 GAGTTGCTTCAGCCTCCACAGGG + Intergenic
1062477917 9:136738507-136738529 GGGTTTCTTTGGGATCCCCTTGG + Intronic
1187632008 X:21183568-21183590 GGGTTGGTTGAGGCTTCTCTGGG + Intergenic
1187713390 X:22076824-22076846 GGATTTCTCTAGGCTCCAGTAGG - Intronic
1190464191 X:50709287-50709309 GACTTGCTTTTGGCTCCACAGGG + Intronic
1199846944 X:151698553-151698575 GGTTTGCTTTGGGCCCTACTGGG + Exonic