ID: 1124090837

View in Genome Browser
Species Human (GRCh38)
Location 15:26598673-26598695
Sequence CTTTCCAAATGCTTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124090837_1124090848 27 Left 1124090837 15:26598673-26598695 CCATTTTCCAAGCATTTGGAAAG 0: 1
1: 0
2: 3
3: 35
4: 279
Right 1124090848 15:26598723-26598745 ACCTCACAAAGAACATTAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 173
1124090837_1124090845 24 Left 1124090837 15:26598673-26598695 CCATTTTCCAAGCATTTGGAAAG 0: 1
1: 0
2: 3
3: 35
4: 279
Right 1124090845 15:26598720-26598742 TTCACCTCACAAAGAACATTAGG 0: 1
1: 0
2: 1
3: 21
4: 268
1124090837_1124090846 25 Left 1124090837 15:26598673-26598695 CCATTTTCCAAGCATTTGGAAAG 0: 1
1: 0
2: 3
3: 35
4: 279
Right 1124090846 15:26598721-26598743 TCACCTCACAAAGAACATTAGGG 0: 1
1: 0
2: 2
3: 15
4: 209
1124090837_1124090847 26 Left 1124090837 15:26598673-26598695 CCATTTTCCAAGCATTTGGAAAG 0: 1
1: 0
2: 3
3: 35
4: 279
Right 1124090847 15:26598722-26598744 CACCTCACAAAGAACATTAGGGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124090837 Original CRISPR CTTTCCAAATGCTTGGAAAA TGG (reversed) Intronic
903300895 1:22378145-22378167 GTGTCCAAGTGCTTGGCAAACGG - Intergenic
903916925 1:26771559-26771581 CTTGCCAAATGTTTGTAAACTGG + Intronic
906542480 1:46598085-46598107 TTTTCCATATTCATGGAAAATGG + Intronic
908988966 1:70061290-70061312 CTTTCTAAATGCTAGGAAAAGGG + Intronic
910554701 1:88518569-88518591 TTTTGCAAATTATTGGAAAATGG - Intergenic
910965941 1:92807927-92807949 CTTTGGAAATGCTTTTAAAATGG + Intergenic
911586090 1:99692541-99692563 CTTGCCATAGGCTTGAAAAAAGG + Intronic
911611582 1:99964266-99964288 ACTTCCAAGTGCTTGGAAATTGG + Intergenic
913674047 1:121124814-121124836 TTTTCCAAATGCTAGGAAGCAGG + Intergenic
914025830 1:143912135-143912157 TTTTCCAAATGCTAGGAAGCAGG + Intergenic
914664267 1:149819855-149819877 TTTTCCAAATGCTAGGAAGCAGG + Intergenic
914671495 1:149873979-149874001 TTTTCCAAATGCTAGGAAGCAGG - Intronic
915572643 1:156752895-156752917 CTTTGCATATGCTTTGAAATAGG - Intronic
916274559 1:162979736-162979758 TTTGCCAAATGCTTGGAACATGG + Intergenic
917534851 1:175866999-175867021 GTTTCCAAAAGCATGGAACATGG + Intergenic
918789340 1:188805935-188805957 CTTTCCACATCCTTTGAAGAGGG + Intergenic
919087351 1:192936239-192936261 CTTTACAAAGGCTGGGAAGATGG + Intergenic
920574185 1:207044722-207044744 CTTTAAAAATGTTTGGAAAAGGG + Exonic
921062263 1:211595605-211595627 CTTTCAAAATGCTTAGAACTGGG + Intergenic
921416318 1:214891541-214891563 CCTTTCACATTCTTGGAAAAGGG - Intergenic
922489026 1:226000329-226000351 CTGTTAAAATGCTTGGCAAATGG + Intergenic
923811836 1:237326752-237326774 ATTTTCAAATGCTTGCAAATGGG + Intronic
924863317 1:247949986-247950008 CTTTCAAAATTTTTGGAAAAAGG - Intronic
1062907192 10:1187046-1187068 CTTTCGAAGTGGTTGGCAAATGG - Intronic
1064343671 10:14509925-14509947 CTATACAAATGCTTGCAAATAGG - Intergenic
1064711011 10:18124739-18124761 TTTTCCACATGCTTAGAAAAAGG + Intergenic
1064793297 10:18983763-18983785 CTTTGCATATTCTTGTAAAATGG + Intergenic
1065793845 10:29287891-29287913 TTTTCAAAATGCTTTGAAATAGG - Intergenic
1067027674 10:42858532-42858554 CTTTCCAAATGCCTGGAGAGTGG - Intergenic
1067725993 10:48771492-48771514 ATGTCAAAATGCTTAGAAAAGGG + Intronic
1069809200 10:71145961-71145983 CTTTCCAGATTCTTTGTAAAAGG - Intergenic
1072465828 10:95661600-95661622 CTTTCCAAGTGTTTTGGAAAAGG + Intergenic
1073088208 10:100909599-100909621 CTGCCCAAGTGCTTGGAAAAAGG - Intergenic
1073501604 10:103943364-103943386 CTTTCCAAATGCTTGTCATTTGG + Intergenic
1075433644 10:122414004-122414026 CTTTCTTTATGCTTGGCAAAGGG + Intronic
1076222127 10:128742535-128742557 CTATCCAAATGGGTGGACAATGG + Intergenic
1077512428 11:2975471-2975493 CTCTCAAAATGCTGGGATAACGG - Intronic
1078744988 11:14104143-14104165 CTTTAAAAAGGCTTAGAAAAAGG - Intronic
1079032332 11:16994834-16994856 CTGTGCAAATGCTTTGAGAAGGG - Intronic
1079508511 11:21182831-21182853 CTCTTCAAATGTTGGGAAAACGG + Intronic
1084784939 11:71436928-71436950 GTTTTCACATCCTTGGAAAATGG + Intronic
1088549346 11:110995514-110995536 ATTTCCACAGGCTTGGAAATTGG - Intergenic
1088964516 11:114704658-114704680 CTTGCTAAATGCATGAAAAAGGG - Intronic
1089095550 11:115917240-115917262 CTTTCTGAATGTTTGGAACATGG - Intergenic
1091482781 12:851258-851280 CTTTCAAAATGATTGGAGGAAGG + Intronic
1091486174 12:891117-891139 CTTTTCAAATCATTGGAAGATGG + Intronic
1091508199 12:1094665-1094687 CTTCCCAAATGCTAGGATTACGG + Intronic
1091829560 12:3540045-3540067 ATTTCAAAGTGCTTAGAAAAGGG - Intronic
1091885840 12:4016436-4016458 TGTTCCAAATGCTGAGAAAATGG - Intergenic
1092760833 12:11809770-11809792 CTTGGCTATTGCTTGGAAAATGG + Intronic
1092820460 12:12349338-12349360 CTTTGCAAAAGCTTGAAAAGAGG - Intronic
1093685628 12:22050479-22050501 CTCTCCCATTGCTTGTAAAACGG + Intronic
1093795643 12:23307339-23307361 CTTTGCAAAAGCCTAGAAAAGGG + Intergenic
1094123627 12:26999648-26999670 CTTTCCAATTCCTCGGAAACAGG - Exonic
1096453529 12:51766243-51766265 CTTTCCTAACTCTAGGAAAAGGG - Intronic
1098823206 12:75259518-75259540 CTTGCTGAATGCTTGGAACATGG - Intergenic
1099259237 12:80355807-80355829 CTATACAAATGTTTGGAGAATGG + Exonic
1099475418 12:83103043-83103065 CTTTCCAAAGGCAAGGAAGAGGG + Intronic
1100794111 12:98162334-98162356 CTTTACAATTCCATGGAAAATGG + Intergenic
1101494621 12:105241878-105241900 CTTTTCAAATGCTTGTTGAATGG + Intronic
1103224814 12:119277619-119277641 CTTTCCAAATGTTTGCAGAGGGG + Intergenic
1103667919 12:122585341-122585363 CTTTGCAAATGATTAAAAAACGG - Intronic
1104105294 12:125653269-125653291 CTTTCAAAATGTTTTTAAAAAGG + Intronic
1107567046 13:41615390-41615412 CTTACCAGATGCAGGGAAAATGG + Intronic
1107852373 13:44583503-44583525 GATGCCAAATGCTTGAAAAAAGG + Intergenic
1108115289 13:47120792-47120814 TGTTCCAAATGCTGGGACAAGGG - Intergenic
1108458317 13:50639405-50639427 GTTTCCAAATGACAGGAAAAAGG - Intronic
1108758683 13:53535365-53535387 GTTTCCAAGTGCTTGACAAAGGG - Intergenic
1110155506 13:72311941-72311963 CTTTCTAACTGCTTTCAAAATGG + Intergenic
1111383998 13:87499500-87499522 CTTTCCAAATGCTTGCAAGTTGG + Intergenic
1112597646 13:100823175-100823197 CTTTCCAGAAGCTGTGAAAATGG + Intergenic
1114718672 14:24856380-24856402 CTTCCCAATTTCCTGGAAAAGGG + Intronic
1115764324 14:36607255-36607277 ATTTCCTGATGCTTGGAACAAGG - Intergenic
1115766464 14:36628190-36628212 CTTTCCATGTGCTTTGAAAAAGG + Intergenic
1116049363 14:39784363-39784385 CTTTCCTAAAGCTTAGAGAATGG - Intergenic
1116309381 14:43303295-43303317 CTTTGCTAATGCTTTGCAAAAGG + Intergenic
1117586132 14:57207533-57207555 CTTCAGAAATGCTTTGAAAAAGG + Exonic
1118554436 14:66999728-66999750 CTTTTCAAAGGATTTGAAAAGGG - Intronic
1119625976 14:76175949-76175971 ATTTCCAAAAAATTGGAAAACGG - Intronic
1120273573 14:82344814-82344836 ATTTCCAAATTTTTGTAAAATGG + Intergenic
1121372100 14:93368780-93368802 CTTTTCCAATTCTTTGAAAATGG - Intronic
1123427321 15:20183364-20183386 CGTTCCAAATGCCTGGAGAGTGG - Intergenic
1123536557 15:21189914-21189936 CGTTCCAAATGCCTGGAGAGTGG - Intergenic
1124090837 15:26598673-26598695 CTTTCCAAATGCTTGGAAAATGG - Intronic
1125121850 15:36169239-36169261 GTTTCCAGATGCTTGGGATATGG - Intergenic
1125444037 15:39733750-39733772 CTTTCTGTCTGCTTGGAAAATGG + Intronic
1125539417 15:40461313-40461335 CTTTCATAATGCTTGGGAATAGG - Intronic
1125753604 15:42047227-42047249 CTCTCAAAATGCTGGGATAATGG + Intronic
1126252383 15:46583918-46583940 ATTTCCAAATACTTGGCAGATGG - Intergenic
1126390566 15:48145969-48145991 CTTGTCAACTGCATGGAAAATGG - Intronic
1126431383 15:48588940-48588962 CTGGCCAGATGCTTGGACAATGG + Intronic
1127561921 15:60147136-60147158 CTTTACACATGCTTGTAAAAAGG - Intergenic
1128793363 15:70448944-70448966 CCTTCCAAGTGCTGAGAAAAAGG + Intergenic
1130485874 15:84398271-84398293 CTTTCCAAATGGCTGGAGAGTGG - Intergenic
1130544667 15:84846105-84846127 CATTGGAAATGCTTGGAAAATGG + Intronic
1131849306 15:96522011-96522033 CTTTCAAAAGGCTTGGATTACGG - Intergenic
1135902433 16:26475050-26475072 CTTTGCAACTGCTTTGGAAAGGG + Intergenic
1136006048 16:27329903-27329925 TGGTGCAAATGCTTGGAAAAGGG + Intronic
1137827333 16:51510531-51510553 CTTTCTATATGCTTGGAGACTGG + Intergenic
1137854517 16:51780478-51780500 CTTGCCAAGTGCTTGGAAGAAGG + Intergenic
1138346493 16:56323516-56323538 CTTTCCTAATGCCTGGAACTTGG - Intronic
1138352257 16:56352288-56352310 CTTTCCAAATGGATGGATGAGGG + Intronic
1138696311 16:58816702-58816724 CTAACCAAAGGCTTAGAAAAAGG - Intergenic
1138750622 16:59415739-59415761 ATTTCCAAGTGCTTTGAAACAGG - Intergenic
1138902440 16:61289524-61289546 CTTAACAAAAGCTAGGAAAAGGG - Intergenic
1139271181 16:65684323-65684345 CTTACCAAATTCTTGGCAAAAGG - Intergenic
1141490697 16:84370605-84370627 CTTTCCAAACCCTGGGAGAAAGG - Intronic
1203118541 16_KI270728v1_random:1514921-1514943 CGTTCCAAATGCCTGGAGAGTGG + Intergenic
1144176557 17:12713141-12713163 CTTCCCAAGTGCTTGCTAAATGG + Intronic
1144445107 17:15320030-15320052 CTTGTCAAAACCTTGGAAAAAGG - Intronic
1144558216 17:16300344-16300366 CTGTGAAAATGCTTGGTAAAAGG - Intronic
1144853788 17:18257381-18257403 CTTTGCAAAGGCTTGGAAGGGGG - Intronic
1147880517 17:43650667-43650689 CTTGGCAAATCCTCGGAAAACGG + Intronic
1149036722 17:52142514-52142536 TTTTGAAAATACTTGGAAAATGG + Intronic
1149317766 17:55455073-55455095 GTATCAAAATGCTTTGAAAAGGG - Intergenic
1149886823 17:60348426-60348448 CTCTCCAAAGGCCAGGAAAAGGG + Intronic
1151404517 17:73877951-73877973 ATTTCCAAATGCCTGGCACATGG + Intergenic
1154102854 18:11492050-11492072 CTTAGCAAATGCCTGGAAAATGG - Intergenic
1155130660 18:22931534-22931556 CTTTAAAAATGCTTTTAAAATGG + Intronic
1155679741 18:28474642-28474664 CATTCCAAATGTTGGGAAATCGG - Intergenic
1157257768 18:46153647-46153669 CTTTAAAGATGCTTGGAGAATGG + Intergenic
1158296677 18:56004101-56004123 CTTTTAAAAAGTTTGGAAAATGG + Intergenic
1158826124 18:61222193-61222215 GTTTGAAAATGCTTGGGAAATGG - Intergenic
1159343101 18:67162624-67162646 CTTCAGAAATTCTTGGAAAATGG + Intergenic
1159629635 18:70734767-70734789 CTTTCCAAATACTTGGAAACAGG + Intergenic
1159933729 18:74342296-74342318 ATTTCAAAATGCTCGGAGAAAGG + Exonic
1160401672 18:78614792-78614814 CTCTCCTAATGGTTGGAAACTGG + Intergenic
1165351345 19:35277602-35277624 CTTTTCAAAGCCTTGGATAATGG - Intronic
1166443773 19:42840222-42840244 TTTTCCATATGTATGGAAAAAGG + Intronic
1166900926 19:46062236-46062258 CCTTCCAAATGCTCCGAGAAAGG + Intronic
1167100066 19:47399224-47399246 ATTTCCAGATTCTGGGAAAAGGG + Intergenic
925826586 2:7854727-7854749 CTTTCCAATTACTTAAAAAATGG + Intergenic
925840015 2:7982618-7982640 CTTACAAAATGATTAGAAAATGG - Intergenic
925859165 2:8158376-8158398 TTTCCCAAATGCTGGGAAGAGGG - Intergenic
925946557 2:8869447-8869469 TTTTCCAGTTGATTGGAAAAGGG - Intronic
928077991 2:28282688-28282710 CTTTCTTAATGCTAAGAAAAAGG - Intronic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
931811903 2:65862455-65862477 GTTTCCACATGCCTGGAATAAGG - Intergenic
940413478 2:153393440-153393462 TTTTCCTAATGGTTGGAAATGGG - Intergenic
943494116 2:188598100-188598122 CCTTCAAAATGTTTGAAAAATGG - Intergenic
943830683 2:192457750-192457772 CTTTTCTAATTTTTGGAAAAAGG + Intergenic
943834308 2:192499898-192499920 CTTATCATATACTTGGAAAATGG + Intergenic
944632472 2:201641502-201641524 TATTCCTAATGCTTAGAAAAGGG - Intronic
944789692 2:203111992-203112014 TTGTCCACATGCCTGGAAAAAGG + Exonic
945043562 2:205762875-205762897 CAATCCAAATGTTTGGAGAATGG - Intronic
945330293 2:208531175-208531197 CTTGACATATGCTTAGAAAAAGG - Intronic
946965304 2:225031007-225031029 CTTACTAAATGCTTGCCAAATGG - Intronic
1170056305 20:12208177-12208199 CTTTCCAAATGCAAACAAAAGGG - Intergenic
1172386916 20:34540422-34540444 ATCTCCAAATGCTGGGAAAACGG - Intronic
1172951017 20:38723706-38723728 CTCTCCAAATGCGTGCAGAATGG - Intergenic
1173085449 20:39911809-39911831 CTTTGCAAATGCTGAGAAAAGGG - Intergenic
1173185384 20:40836391-40836413 CTCCCCAAAATCTTGGAAAAAGG + Intergenic
1173443519 20:43097722-43097744 TTTTCCATATTCTTGGAAGAGGG + Intronic
1174171931 20:48623126-48623148 TTTTCCAAAGGATTGGAAATCGG + Intergenic
1174906913 20:54561440-54561462 CTTTCCTACTGATTCGAAAATGG + Intronic
1175270291 20:57729116-57729138 ATTTTTAAATGGTTGGAAAAAGG + Intergenic
1176696338 21:9981932-9981954 CTTTCAAAATGCCTGGCAAAGGG + Intergenic
1177338716 21:19768840-19768862 CTTTCATTATGCTTGTAAAAAGG + Intergenic
1179073461 21:38094870-38094892 TTTCTCAAATGGTTGGAAAATGG + Intronic
1179111023 21:38445345-38445367 CTTTGCAAAGGATAGGAAAATGG + Intronic
1179799554 21:43804569-43804591 CTTTCCACCTGCATGGAACAAGG + Exonic
1181371482 22:22421715-22421737 CTCACCAACTCCTTGGAAAACGG - Intergenic
1181575876 22:23794374-23794396 AGTTACAAATGCTTGGAAAGTGG + Intronic
1182081293 22:27530719-27530741 CTTCCCACATGCCAGGAAAAGGG - Intergenic
1182167375 22:28189701-28189723 CTGTCAAAATCCTGGGAAAATGG + Intronic
1183021911 22:35034072-35034094 CTTTCCAGGTGCTTTGAACAAGG + Intergenic
1203293711 22_KI270736v1_random:20233-20255 TTTTCCAAATGCTTGGAGTTTGG - Intergenic
949343650 3:3055901-3055923 CTTTACAAATGCTTTGACAGAGG + Intronic
949895145 3:8762947-8762969 CTTGCCAAATACGTGGAAAATGG - Intronic
951331457 3:21374122-21374144 CTCTACATATGCTTGGAAAATGG + Intergenic
952267773 3:31802800-31802822 TTTTCCCACTACTTGGAAAAAGG + Intronic
952777158 3:37057622-37057644 CTCTCCAAATGCTGGGATTATGG + Intronic
955962477 3:64355127-64355149 CATTCCAGCTGCTGGGAAAAGGG + Intronic
956175680 3:66471204-66471226 CTTTGCAGAGGCTTGGAAATGGG + Intronic
956812973 3:72882159-72882181 CTTTTCAAATTCTGGGACAATGG + Intergenic
957639581 3:82834392-82834414 CTTTCCTAAGCCTTGGTAAATGG + Intergenic
959611316 3:108298090-108298112 CTATGCAGATACTTGGAAAAGGG - Intronic
960365744 3:116770294-116770316 GCTTCAAAATGCTTTGAAAAAGG - Intronic
960814394 3:121658168-121658190 CTTTGAGGATGCTTGGAAAAGGG - Intronic
960887009 3:122406061-122406083 CTTTAAAAATGCTTGGAAGGAGG - Intronic
960911135 3:122650550-122650572 CTTGCCAAATGCTGAGGAAATGG - Intergenic
962880821 3:139574817-139574839 CTTGCCAAATGCTGGGGAAGTGG + Intronic
963242812 3:143026357-143026379 CTTTCCAAAATATTGCAAAATGG - Intronic
963690225 3:148490304-148490326 CTTTCCCAATGCTATGAAAAAGG - Intergenic
965190207 3:165518097-165518119 CATTCCAAATTCCTGGAAATTGG - Intergenic
965370461 3:167855816-167855838 CTTTCCAAGTGCTTGGAACTAGG + Intergenic
965501174 3:169457902-169457924 CTTTCCTCGTGCTTAGAAAAAGG - Intronic
966210545 3:177448960-177448982 CTTTATAAAAGCTTGAAAAATGG - Intergenic
966456450 3:180121782-180121804 ATTTCCAAATACTTGGCAGAAGG + Intergenic
968270713 3:197401228-197401250 TTTTCCAAAGGCTAGAAAAAAGG - Intergenic
970891641 4:21052186-21052208 AATTCCAAACGCTTGGAAAATGG - Intronic
971466314 4:26966232-26966254 ATTTCCAACTACTAGGAAAAGGG - Intronic
972040388 4:34588507-34588529 CTTTCCAAATGTTTTAAAACTGG + Intergenic
972934819 4:44120718-44120740 ATTTCCAGAGGCTTGAAAAAAGG + Intergenic
973549402 4:52017607-52017629 TTTTCATAATGCCTGGAAAAAGG + Exonic
974545264 4:63297591-63297613 CTTGAAAAATGCTAGGAAAAAGG - Intergenic
975185747 4:71400167-71400189 CTTGCCAAATTCCTGGCAAAAGG - Intronic
975442589 4:74429046-74429068 CTTTCTAGCTGCTTGGAATATGG - Intergenic
978275447 4:106943843-106943865 ATTTCCAGATGATTAGAAAAGGG - Intronic
978425046 4:108573337-108573359 TTTTCCAAACACATGGAAAATGG + Intergenic
979018840 4:115468605-115468627 CTTTCCAAAAGCTAAGAATAGGG - Intergenic
979472210 4:121111966-121111988 CTTTAGAAATGCTTTAAAAATGG - Intergenic
979659198 4:123233580-123233602 CTTTCCAACTGCTTAAAAACAGG + Intronic
980143867 4:128956103-128956125 CATTCCAAATGTTTTGCAAACGG - Intronic
980368951 4:131842097-131842119 CTTTCAAAATGCCTGGCAAAGGG + Intergenic
980581424 4:134758613-134758635 CTTTCAAAATGTTTGGAATCAGG - Intergenic
982154698 4:152507045-152507067 GTTTCTAGATGGTTGGAAAAGGG - Intronic
982616284 4:157640096-157640118 CCATCCAAATACTTGGAAACCGG + Intergenic
983564954 4:169140399-169140421 CTTACCAAATGCTTGGAAGAAGG - Intronic
983593627 4:169441713-169441735 CTTTCCAGGGGCTTGGGAAAGGG + Intronic
984622507 4:181970254-181970276 ATTTCCAAATATTTGCAAAACGG + Intergenic
985123997 4:186672908-186672930 ATTTTCAAATGTTGGGAAAACGG - Intronic
986817138 5:11425316-11425338 CTATCCTAATGCCTGGAAAGGGG + Intronic
987008057 5:13731329-13731351 CTTTTCAATTTGTTGGAAAATGG - Intronic
987139781 5:14933178-14933200 CTTTTCGAATGATTGTAAAATGG + Intergenic
987629965 5:20457658-20457680 CCTTCCAAATTCTTAGAAAAGGG - Intronic
988437260 5:31191056-31191078 CTTTCTAATTTCTTAGAAAATGG - Intergenic
989228432 5:39057519-39057541 CATTTAAAATGGTTGGAAAAAGG + Intronic
989846453 5:46149889-46149911 CTTCCCAGATTCTTTGAAAATGG - Intergenic
991283258 5:64940105-64940127 CTGTTCACATGCCTGGAAAAGGG - Intronic
991943477 5:71877482-71877504 CTGTCCATGTGCATGGAAAAAGG + Intergenic
994700918 5:103133988-103134010 CTTTCCAAATGTTAGGATATTGG - Intronic
995195394 5:109361194-109361216 ATTTCCAAATACTTCCAAAAGGG - Intronic
996798630 5:127378194-127378216 CTTTCCTCATGCTTTGAACAAGG + Intronic
997637428 5:135424250-135424272 ATATCAAAATGTTTGGAAAATGG - Intergenic
999152269 5:149434058-149434080 CTTTCCACATGCTTGGGGAATGG + Intergenic
999838201 5:155397354-155397376 CTTTGCAAAGGCTAGGAACACGG - Intergenic
1000227008 5:159272627-159272649 GTTTTAAAATACTTGGAAAAAGG + Intronic
1000275608 5:159732265-159732287 CTTTTCACATGCTTGGGAATAGG + Intergenic
1000464916 5:161563837-161563859 CTTTCCTAATGCATGTAAAGTGG + Intronic
1002695280 5:181084522-181084544 CTTTCCAAAAGCTTAGAGGAAGG + Intergenic
1004172879 6:13312019-13312041 CATTTCAAATCCGTGGAAAAAGG + Intronic
1008085655 6:47241530-47241552 ATTTCTAAATGCTTGAAAGAAGG + Intronic
1008299961 6:49824427-49824449 CTTTCAGAATGCATCGAAAAGGG + Intergenic
1011806868 6:91081927-91081949 CTTGCTAAATGCATGGAAAATGG + Intergenic
1012498749 6:99864876-99864898 CTTACCAAATGGCAGGAAAAAGG + Intergenic
1012510719 6:99998421-99998443 CTTTCCAACTTCTTGAAGAATGG + Intergenic
1012681340 6:102185327-102185349 CTTTCCACATGTTAGGAAACAGG - Intergenic
1013395393 6:109732295-109732317 CTTTGCAAATGCTTTGAGGATGG - Intronic
1013428764 6:110037658-110037680 CATGCCAAATGCATGGAAAAGGG + Intergenic
1014878640 6:126693690-126693712 ATTTGCAAATGCTTGAAAAGTGG + Intergenic
1018046777 6:159972330-159972352 CATTCCAAATGTTTGTAAATTGG + Intronic
1020707500 7:11564145-11564167 CTTTCCAAATATTTGAAAAAAGG + Intronic
1020997303 7:15280281-15280303 CTTGCCAAATGCATGGAAGCTGG + Intronic
1022295465 7:29047249-29047271 GTTTCAGAATGGTTGGAAAAGGG + Intronic
1023047811 7:36226540-36226562 CTACTCAAATGCTTGGGAAATGG + Intronic
1023544135 7:41299182-41299204 CTTTCCTAATGCTTGGATTTTGG + Intergenic
1024081589 7:45860696-45860718 CTTTCCAAATTCTTGGGGACAGG - Intergenic
1024943498 7:54785713-54785735 GTTTCCAACTGCTTGGTAAATGG + Intergenic
1025040756 7:55642999-55643021 CTTTTAAAATGCATGGAAAGAGG - Intergenic
1027908435 7:84215690-84215712 AATTCCAAATGCTAGGAATATGG - Intronic
1028313507 7:89369600-89369622 CCCTCCAAATGCTTGAAAACAGG + Intergenic
1029996204 7:105010940-105010962 GTTTCCATTCGCTTGGAAAATGG + Intergenic
1031114142 7:117649160-117649182 CTTTATAATTGCTTGGGAAATGG - Intronic
1031563227 7:123263342-123263364 CTTTCCTTGTGCTTGGAAATTGG + Intergenic
1031678666 7:124643510-124643532 CTTTCTGAATGCTTCCAAAATGG - Intergenic
1032458938 7:132095062-132095084 GCTTCCAAATGCCTGGAAGAAGG + Intergenic
1033029955 7:137816402-137816424 CATGCAAAATGCTTGGAACAGGG + Intronic
1033350751 7:140559810-140559832 CTTTCCAACTGCAGGGAGAAAGG + Exonic
1036205669 8:6804045-6804067 CTTTCCAAGTACTGTGAAAATGG + Intergenic
1036282452 8:7413055-7413077 ATTTGAAAATTCTTGGAAAAGGG - Intergenic
1036339019 8:7898494-7898516 ATTTGAAAATTCTTGGAAAAGGG + Intergenic
1036571512 8:9983688-9983710 CTTTCAAACTCCTTGAAAAATGG - Intergenic
1036671876 8:10795007-10795029 GTTTCCAAATACTTTTAAAAAGG + Intronic
1037046749 8:14314916-14314938 ATTTGCAAATGTTTGCAAAATGG + Intronic
1037137032 8:15475010-15475032 CTTTCCAAATGTTTTGACGATGG + Intronic
1037157835 8:15727121-15727143 CTTTCAAAATCCTTTGAAAGAGG - Intronic
1038111346 8:24502825-24502847 CTTTCCAGATAATTGGAAAGAGG + Intronic
1038147189 8:24908976-24908998 CTTTCATAATCCTTTGAAAATGG - Intergenic
1038845726 8:31227996-31228018 GTTTCCAAGGGCTGGGAAAATGG + Intergenic
1041444091 8:57931258-57931280 TTCTCCAAATGCTTGTAAACTGG - Intergenic
1043219056 8:77635681-77635703 CTCTGCCAATGCTTGGTAAAGGG + Intergenic
1043296566 8:78670540-78670562 ATGGCCAAATGTTTGGAAAATGG - Intronic
1043375022 8:79639329-79639351 GTTTTCAAATACTTGAAAAATGG + Intronic
1044568865 8:93696212-93696234 GTTAGCAAATGCTTGGTAAATGG - Intergenic
1044668235 8:94652712-94652734 CTTAATAAATGCTTGGCAAAGGG - Intronic
1046793834 8:118349057-118349079 TTATCCATATGCTTGGAGAAAGG + Intronic
1047028393 8:120849637-120849659 ATTTCAAAATGCTTTGGAAATGG - Intergenic
1047484006 8:125312256-125312278 CATTTCAGATGCTTAGAAAATGG + Intronic
1048500843 8:134973770-134973792 CTTTCAAACTGCATGGATAAAGG + Intergenic
1048665095 8:136652286-136652308 CTTTCCAAATTTGTGAAAAAGGG + Intergenic
1049296565 8:141843615-141843637 CTTTCCACCTGGGTGGAAAATGG + Intergenic
1050202313 9:3158477-3158499 TATTCCAGATGCTTGGAGAATGG - Intergenic
1050249014 9:3724084-3724106 TTTTCCAATTCCTTGAAAAATGG - Intergenic
1052269089 9:26607688-26607710 CTGTAAAAATGCTTGGATAAGGG + Intergenic
1053633311 9:39967772-39967794 CTTTCAAAATGCCTGGCAAAGGG + Intergenic
1053772435 9:41495708-41495730 CTTTCAAAATGCCTGGCAAAGGG - Intergenic
1054210576 9:62282925-62282947 CTTTCAAAATGCCTGGCAAAGGG - Intergenic
1054314408 9:63565997-63566019 CTTTCAAAATGCCTGGCAAAGGG + Intergenic
1054322752 9:63688031-63688053 ATTTCTAAATGCTTGGGAATTGG - Intergenic
1055519837 9:77069868-77069890 CTCTCCTAATGCTTCCAAAAAGG + Intergenic
1055576975 9:77670384-77670406 AACTCCAAATTCTTGGAAAAGGG - Intergenic
1056288077 9:85111729-85111751 CCTTCCAAAAGCATGGAGAATGG + Intergenic
1056595705 9:88006478-88006500 GTTTCCAAAATCATGGAAAAAGG + Intergenic
1056629976 9:88285397-88285419 CTTTCAAAATGCTATGAGAATGG + Intergenic
1058076609 9:100657726-100657748 CTTTCCAAATGGGAGGAAACTGG - Intergenic
1059128537 9:111719187-111719209 ATGTAAAAATGCTTGGAAAATGG + Intronic
1059816763 9:117925132-117925154 CTTTTCAAATGCATGAAAGAGGG - Intergenic
1061670588 9:132186017-132186039 CTTTCTAATTGATTAGAAAAAGG - Intronic
1187641583 X:21296984-21297006 AATTACAAATGTTTGGAAAATGG + Intergenic
1187763912 X:22618527-22618549 CTTTCCCAACCCTAGGAAAAGGG + Intergenic
1187815347 X:23225525-23225547 CATTTCAAATGCTGGGAACAGGG + Intergenic
1187871017 X:23765517-23765539 CTGTCCCAATGCTTTGAAAATGG - Intronic
1188573184 X:31614102-31614124 CTTTACAAATATTTGGAAAATGG - Intronic
1190212184 X:48457870-48457892 ATTTCTAAATGATTGAAAAAAGG - Intergenic
1190792832 X:53715982-53716004 CTTACCACATGCTAGGAAATAGG - Intergenic
1192176264 X:68887432-68887454 CAGTCAAACTGCTTGGAAAAGGG + Intergenic
1192308876 X:69992066-69992088 CTGGCCAAAGGATTGGAAAAAGG - Intronic
1192408442 X:70910301-70910323 GTTTCCTAATGATTGGACAAAGG - Intergenic
1192841089 X:74856994-74857016 CATTCCAACTGCTGGGAAATGGG - Intronic
1193601248 X:83510220-83510242 CTTTTTAATTGCTTAGAAAAGGG + Intergenic
1195928687 X:110051687-110051709 CTTTCCAGTTGCTTGAAGAAGGG + Intronic
1196569559 X:117249433-117249455 CTGTGTTAATGCTTGGAAAAAGG + Intergenic
1197399582 X:125974084-125974106 CCTTCCATGTGCTTGGAAGAGGG + Intergenic
1198015819 X:132609690-132609712 CTTTGGAAATTCTTGGAAACCGG + Intergenic
1198157912 X:133981045-133981067 ATTTCCTAATGCTTCCAAAATGG + Intronic
1198507290 X:137313289-137313311 CTTTTCAAATGCATTGACAATGG - Intergenic
1199026454 X:142944304-142944326 CTTTTCAAATGCTTGAAAATAGG - Intergenic