ID: 1124092996

View in Genome Browser
Species Human (GRCh38)
Location 15:26623833-26623855
Sequence AGGGTGGGTCAGGCAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 12, 3: 75, 4: 542}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124092996_1124093007 7 Left 1124092996 15:26623833-26623855 CCCTCTGCTGCCTGACCCACCCT 0: 1
1: 0
2: 12
3: 75
4: 542
Right 1124093007 15:26623863-26623885 CCTGAGCAGCCCCCATGGCATGG 0: 1
1: 0
2: 0
3: 33
4: 283
1124092996_1124093004 2 Left 1124092996 15:26623833-26623855 CCCTCTGCTGCCTGACCCACCCT 0: 1
1: 0
2: 12
3: 75
4: 542
Right 1124093004 15:26623858-26623880 CACTCCCTGAGCAGCCCCCATGG 0: 1
1: 1
2: 3
3: 35
4: 305
1124092996_1124093008 12 Left 1124092996 15:26623833-26623855 CCCTCTGCTGCCTGACCCACCCT 0: 1
1: 0
2: 12
3: 75
4: 542
Right 1124093008 15:26623868-26623890 GCAGCCCCCATGGCATGGTGTGG 0: 1
1: 0
2: 1
3: 25
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124092996 Original CRISPR AGGGTGGGTCAGGCAGCAGA GGG (reversed) Intronic