ID: 1124096006

View in Genome Browser
Species Human (GRCh38)
Location 15:26649339-26649361
Sequence CTGGGTCATCACATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4024
Summary {0: 1, 1: 17, 2: 413, 3: 1251, 4: 2342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124096006 Original CRISPR CTGGGTCATCACATGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr