ID: 1124096291

View in Genome Browser
Species Human (GRCh38)
Location 15:26651400-26651422
Sequence AGCAAGTAGCTGAATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124096291_1124096292 -8 Left 1124096291 15:26651400-26651422 CCTTCTGCATTCAGCTACTTGCT 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1124096292 15:26651415-26651437 TACTTGCTGATAAAAACCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 172
1124096291_1124096295 8 Left 1124096291 15:26651400-26651422 CCTTCTGCATTCAGCTACTTGCT 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1124096295 15:26651431-26651453 CCAGAGGGTGTACTGACTTGTGG 0: 1
1: 0
2: 1
3: 5
4: 123
1124096291_1124096296 9 Left 1124096291 15:26651400-26651422 CCTTCTGCATTCAGCTACTTGCT 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1124096296 15:26651432-26651454 CAGAGGGTGTACTGACTTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 72
1124096291_1124096293 -7 Left 1124096291 15:26651400-26651422 CCTTCTGCATTCAGCTACTTGCT 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1124096293 15:26651416-26651438 ACTTGCTGATAAAAACCAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124096291 Original CRISPR AGCAAGTAGCTGAATGCAGA AGG (reversed) Intronic
901695524 1:11004950-11004972 AGCAACCAGATGAATTCAGAAGG + Intergenic
903331446 1:22599125-22599147 TGCAAGTAGCTGAATGAAGTTGG + Intronic
904045366 1:27605104-27605126 AGCAAGTGGCTGAACCCAGCTGG + Intergenic
905288151 1:36899761-36899783 TGAAAGTAGCTGTATTCAGATGG + Intronic
905551204 1:38841292-38841314 ACCCAGGAGCTGAATGCATAGGG + Intronic
906427969 1:45729613-45729635 AGAAAGTACCTGTATGCAGTAGG - Exonic
907384538 1:54117591-54117613 GGGAAGTAGGTGTATGCAGAAGG - Intergenic
907727175 1:57030402-57030424 AGCCAGGAGCTGAATCCTGAAGG + Intronic
910746484 1:90580381-90580403 GGCAAGTAGCGGCGTGCAGAAGG - Intergenic
915169195 1:153965986-153966008 AACAAGCAGATGACTGCAGAGGG + Intronic
915611417 1:156996422-156996444 AGGAAGCAGCAGAAGGCAGAGGG + Intronic
915629420 1:157139923-157139945 AGCTAGTAGATGAAGGCACAAGG - Intergenic
917231755 1:172845285-172845307 AGGATGTAGATGAGTGCAGAGGG - Intergenic
919233300 1:194804462-194804484 AACAAGTAGATGAGTGCATAAGG - Intergenic
920712680 1:208310116-208310138 TGGAAGCAGCAGAATGCAGATGG - Intergenic
923288656 1:232522208-232522230 AGCAAGCAGCTTTATTCAGAGGG - Intronic
923865242 1:237932554-237932576 AGGAAGTATCTGAATGGGGAGGG - Intergenic
1064068214 10:12201967-12201989 AACAACTAGATGAATGAAGATGG + Intronic
1064697232 10:17979965-17979987 AGGAAGTAGATATATGCAGAGGG + Intronic
1065445058 10:25789591-25789613 AGCACGTAGCTCATTGCACATGG - Intergenic
1065515530 10:26520548-26520570 GGCAAGAAAGTGAATGCAGAGGG + Intronic
1065786919 10:29224483-29224505 AGGAAGTAGCTAAATGGGGAGGG + Intergenic
1065839722 10:29692368-29692390 AGGAAGTGGCTGAATGCAATGGG - Intronic
1066758105 10:38730446-38730468 CGCAAGGAGCTGAAGGCAGCGGG + Intergenic
1067982866 10:51106964-51106986 TACAAGTAAGTGAATGCAGATGG + Intronic
1070505891 10:77112380-77112402 AGCACGTGGCTGACTGCAGCCGG - Exonic
1071174281 10:82906036-82906058 AGCACGTAGCTGGGTGCAGAAGG - Intronic
1072587908 10:96798958-96798980 AGCCATTGGCTGAATGGAGAAGG - Intergenic
1073662282 10:105489759-105489781 AGCAAAGAGGTGAATGGAGAAGG - Intergenic
1074580179 10:114711722-114711744 AGTGAGTAGCTGAGTGGAGAGGG + Intergenic
1075151682 10:119938407-119938429 AGCAAGCAACTACATGCAGAAGG - Intronic
1075546503 10:123358948-123358970 AGCAAGTAGCTGAGACCATAGGG - Intergenic
1075579582 10:123606911-123606933 AGCAAGAAGAAGAAAGCAGAGGG - Intergenic
1079301674 11:19284208-19284230 AGCAGGTAGCTGACTAGAGAGGG - Intergenic
1079605022 11:22354489-22354511 AGTAAGTAGTTAAATGGAGAGGG - Intronic
1080589477 11:33709166-33709188 AGCAGGAGGCTGGATGCAGATGG + Exonic
1080675042 11:34418370-34418392 AGCTAGTGGCAGCATGCAGAAGG + Intergenic
1084060588 11:66670898-66670920 AGCAACTTGCTGATTGCAGAGGG - Intronic
1084720531 11:70902799-70902821 AACAAGTAGAGGAAAGCAGATGG + Intronic
1086304000 11:85460178-85460200 GGAAAGTGGCTGAATCCAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087953783 11:104258167-104258189 AGAAAGGAGCTGTCTGCAGAGGG + Intergenic
1088177665 11:107072451-107072473 AGCAATTAGCTGATTTAAGAAGG + Intergenic
1089873874 11:121701358-121701380 TGCAAGTAGCTCAATCCAGTGGG - Intergenic
1090053404 11:123400967-123400989 AGCTAGTACCTGAACTCAGAAGG + Intergenic
1090208391 11:124898224-124898246 AGCAAGAAGCTGAAGACAGAGGG + Exonic
1090208605 11:124899482-124899504 AGCAAGAAGCTGAGGACAGAGGG + Intergenic
1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG + Intronic
1090588479 11:128239050-128239072 AGCAAGCAACTGTATGTAGATGG - Intergenic
1092045441 12:5429457-5429479 GGCAAGGTGCTGAATGAAGAAGG - Intergenic
1092495665 12:8992419-8992441 AGGAAATAGCTGTATACAGATGG - Intronic
1092770330 12:11891027-11891049 ACCAAGAAGATGAATGCTGAAGG + Exonic
1093170751 12:15857700-15857722 TGCAAGTAGCTCAATGCTGTTGG + Intronic
1093415509 12:18915579-18915601 AGGAAGGAGCTGAATTCATAAGG + Intergenic
1095333146 12:40992788-40992810 AGCAAGGAGCTGTATTCTGAAGG - Intronic
1095671728 12:44869332-44869354 AGCATGGAGCTGACTCCAGAGGG - Intronic
1096095211 12:48930722-48930744 AGAAAGGAGGTGAAGGCAGAGGG + Intronic
1099138185 12:78935166-78935188 AGCAAGTAGGTGTCTGGAGATGG + Intronic
1099441676 12:82706721-82706743 GGTAAGTAGCTGAATGTGGAGGG + Intronic
1100326394 12:93543689-93543711 AGGAAGCATCTGAATGCAGGAGG - Intergenic
1101592576 12:106137940-106137962 AGCAAGGAGCTGCGGGCAGATGG + Intronic
1105941477 13:25151833-25151855 AGCAAGGGGTGGAATGCAGAAGG - Intergenic
1106949763 13:34870340-34870362 AATAAGGAGCTGAATGGAGAGGG - Intergenic
1108057692 13:46500689-46500711 AGCAAAGAGATGAAGGCAGATGG - Intergenic
1108063813 13:46557273-46557295 AGAAAGTGGCTGATTGCAGGAGG + Intronic
1109199229 13:59412106-59412128 AGCAACCAGCTGAATGGAGAGGG + Intergenic
1110761246 13:79232838-79232860 AGGGAGTAACTGGATGCAGATGG - Intergenic
1111746450 13:92275933-92275955 AATAAGCAGCTAAATGCAGAAGG - Intronic
1112036395 13:95500533-95500555 AGCTTGTAGCTGAGTACAGAAGG + Intronic
1117968600 14:61230725-61230747 GGCAAGTAGCTGAAGTGAGAGGG - Intronic
1119318598 14:73715992-73716014 CGCCCTTAGCTGAATGCAGATGG + Exonic
1120572727 14:86141918-86141940 AGCCAGTAACTGAAGGCAAAGGG - Intergenic
1121097798 14:91229843-91229865 AGGATGTAGCAGAATGCAGTGGG - Intergenic
1124096291 15:26651400-26651422 AGCAAGTAGCTGAATGCAGAAGG - Intronic
1124099390 15:26679217-26679239 AGCAAGTACCAGAGGGCAGAGGG - Intronic
1124395539 15:29297947-29297969 ATCTAGCAGCTGAATGCACATGG + Intronic
1125385312 15:39130686-39130708 AGGAAGCAGCTGGATGCAGATGG + Intergenic
1134018246 16:10904107-10904129 AACAAGCAGCTGAAGGCTGATGG - Intronic
1134465413 16:14472384-14472406 GCAAAGTAGCTGAATTCAGAGGG + Intronic
1135058742 16:19253137-19253159 AGCATGTTGATGAATGCACATGG - Intronic
1137690452 16:50423219-50423241 AGCAGCTGGCTGAATGCTGATGG + Intergenic
1137984918 16:53099570-53099592 AGAAAGCAGCTGGAGGCAGAAGG - Intronic
1140223869 16:73063733-73063755 AGCAAGAAGCTGCATGTAGTGGG - Intergenic
1140901036 16:79368077-79368099 AGCAGGGAGCAGCATGCAGACGG - Intergenic
1145854167 17:28136232-28136254 AGTAATTAGCTGACTACAGATGG + Intronic
1145889223 17:28403340-28403362 TGTAAGTAACTGAATGCAAAGGG - Exonic
1156069411 18:33188066-33188088 ATCAATTATCTGAATGCAAAAGG + Intronic
1157936559 18:51879707-51879729 TGCAATTATCTGAATGCTGATGG - Intergenic
1159951264 18:74486121-74486143 AGCAAGCAGCAGGAGGCAGAAGG - Intergenic
1161746429 19:6063108-6063130 ACCAAGTAGCTGGATGCATGAGG - Intronic
1164696630 19:30249688-30249710 AGCAAGTGGCTGAGTTCAGGTGG + Intronic
1165903163 19:39178145-39178167 AGCAAGAAGCTGAAAGCAACTGG - Intronic
1166347751 19:42176904-42176926 TGCAAGAAGCTTAATGCAGCCGG - Intronic
1166663635 19:44663677-44663699 AGCAAGACGCTAAATGAAGAGGG + Intronic
1167286222 19:48600087-48600109 GGCAAGGAGCTGAATACTGAGGG - Intergenic
925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG + Intergenic
925163381 2:1702183-1702205 CGCAAATACCTGAAGGCAGAAGG + Intronic
925329512 2:3047614-3047636 AGCATGCAGAAGAATGCAGAAGG + Intergenic
925921667 2:8642570-8642592 AGCAGTTGGCTGAATGCATATGG - Intergenic
929284910 2:40124982-40125004 TGCAAATGGCTGAATGTAGATGG + Intronic
931418906 2:62107500-62107522 GGCAAGAAGCTGGATGGAGAAGG - Intronic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
934036861 2:88095610-88095632 AGGAAGTGGCAGGATGCAGAGGG - Intronic
935190538 2:100774713-100774735 AGAAAGTAGCTGGAGGGAGAAGG + Intergenic
939188405 2:138887134-138887156 TGCAAGTGACTGAAGGCAGAAGG - Intergenic
940809811 2:158229760-158229782 AGCAAGAAGCTGAAGGTACAGGG - Intronic
941887081 2:170539225-170539247 AGCAAGCAGCTAAATACAGAAGG - Intronic
942503998 2:176622361-176622383 AGAAAGAGGATGAATGCAGAAGG - Intergenic
943175830 2:184472665-184472687 AACCAGTGGCTGAATGCAGCTGG + Intergenic
944563684 2:200966088-200966110 AGCAGGAAGCTGAAGTCAGAGGG + Intergenic
945367227 2:208969757-208969779 AGCAAATAGCTCAATGGAGTTGG - Intergenic
946394810 2:219437922-219437944 AGCAAGGACCTGGCTGCAGACGG + Intronic
947981644 2:234415504-234415526 AGACAGTAGCAGAATCCAGAAGG + Intergenic
948875997 2:240828829-240828851 GGAAAGTAGCTGAATCCAGTCGG + Intergenic
1168813831 20:723215-723237 AGGAAGCAGCTCAATGCAGGTGG + Intergenic
1169309727 20:4525398-4525420 AGCAAATAGCAGCAGGCAGATGG + Intergenic
1170651417 20:18245970-18245992 AGCAAGGAGGTGAGGGCAGACGG - Intergenic
1175163949 20:57029844-57029866 AGGAAATTGCTGCATGCAGAGGG + Intergenic
1176277553 20:64281053-64281075 AGCAAGAAGCTGAACACAAAAGG - Intronic
1184178807 22:42805640-42805662 AGCAAGTAACTGACTGCCCAAGG + Intronic
949592009 3:5504443-5504465 ACCAAGTAGCATAAGGCAGAGGG - Intergenic
949681062 3:6515093-6515115 AGCATGGAGAAGAATGCAGATGG - Intergenic
949810271 3:7999942-7999964 ATCATGTAGCTGAATGCACTTGG - Intergenic
952421183 3:33132578-33132600 AGCAGATAGCTGACTGCACAGGG - Exonic
952933617 3:38378420-38378442 AGCATGTACATGAATGCAGCAGG + Intronic
954081814 3:48216674-48216696 AGCAGGGAGCTGACTGGAGAAGG - Intergenic
956233907 3:67045087-67045109 ACCAATTACCTGCATGCAGAGGG + Intergenic
956917766 3:73891173-73891195 AGGAAGTAGCTTAAAGCAGAGGG + Intergenic
958590552 3:96153920-96153942 AGGAAGGAGCTGAATCCAGGGGG + Intergenic
960685088 3:120287399-120287421 AGAAAGAGGCTGAATCCAGAGGG + Intergenic
964656996 3:159078494-159078516 AGCATGGAGCTGAACACAGAAGG + Intronic
966316019 3:178646027-178646049 TGCAGGTAACTGTATGCAGATGG - Intronic
969053646 4:4388709-4388731 AGCAAGTTGGTGATTGCTGACGG + Intronic
970183724 4:13427436-13427458 AGAAAGTACCTGTAGGCAGAAGG - Intronic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
976351210 4:84061969-84061991 AACACGCAGCTGACTGCAGAAGG - Intergenic
976859140 4:89641393-89641415 AGCAAGCAGCGGAATGCAGCAGG + Intergenic
977128029 4:93195212-93195234 GACAAGGAGTTGAATGCAGATGG + Intronic
977716985 4:100193674-100193696 AGCAAGTGGCTAAATGGAGTTGG + Intergenic
979483384 4:121243859-121243881 TGCAAATAGTTGAATTCAGAGGG - Intergenic
981307744 4:143264524-143264546 AGCAAGTAGCCCAATTCAGGAGG + Intergenic
982184674 4:152783424-152783446 AGCACTTAGCTTAATGCACATGG - Intronic
982315709 4:154029462-154029484 ATCAAGGAGCTAAAAGCAGAAGG + Intergenic
982912398 4:161160888-161160910 AGCAGGAAGCTAAATGCAAAGGG - Intergenic
983077054 4:163338733-163338755 AGCATGTAGTTGATAGCAGAGGG - Intronic
985100053 4:186449984-186450006 AGCAAGGAGCAGATTGCAGGAGG + Intronic
986963959 5:13247575-13247597 AGCCAGGAGCTGAGGGCAGAGGG + Intergenic
990959026 5:61374032-61374054 ATCAAGTAGATGAAAGCAAAAGG - Intronic
991376009 5:65967936-65967958 AGCAAGTGGCTGGTTTCAGAGGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992751033 5:79861213-79861235 AGCCAGTAGCTAAATTGAGATGG - Intergenic
992955930 5:81907982-81908004 TGCAACTTGTTGAATGCAGAAGG + Intergenic
993649633 5:90504033-90504055 AACTAGTAGCTTAATGCAAAAGG + Intronic
993715170 5:91269117-91269139 AGCAAGTAGCTAAACCCAGGAGG + Intergenic
996226241 5:121000635-121000657 AGACAATAGCTGAAGGCAGAGGG + Intergenic
997170112 5:131710480-131710502 AGAGAGTAGATGAATGCAGTTGG - Intronic
998542331 5:142994322-142994344 AGCTAGTAGTTGCATGTAGATGG + Intronic
1001114963 5:168931748-168931770 AGCAAGTAGGTGTATGATGAGGG + Intronic
1002071720 5:176682489-176682511 AGCAAAGTGCTGCATGCAGAGGG - Intergenic
1002618759 5:180471463-180471485 GGCAAGGAGCTGCATGCAAAGGG - Intergenic
1004089904 6:12490203-12490225 GGAAATTAGCTGAATGCAGAGGG + Intergenic
1006340531 6:33443956-33443978 AGCAGGTAGGTGAAGGCAGGAGG + Exonic
1006440766 6:34052337-34052359 AGCAAGTAGCTGATTTAGGAGGG - Intronic
1011861901 6:91768396-91768418 AGCAAGAGGCAGATTGCAGATGG + Intergenic
1012277084 6:97287448-97287470 ACCAAGTAGCTGAATGGTGCTGG - Intergenic
1012863040 6:104584099-104584121 AGAAAAAAGGTGAATGCAGAGGG - Intergenic
1014010700 6:116472570-116472592 AGCAAGTAGATGGATGCATAGGG + Intergenic
1015043532 6:128750599-128750621 AGCAAATATCTAAATGCAAAGGG - Intergenic
1016101733 6:140110219-140110241 AGTAAGTATCTGAATGAAAAAGG - Intergenic
1016891218 6:149008682-149008704 AGCAAGAGGCTGACAGCAGAAGG + Intronic
1020026719 7:4904847-4904869 TGCAAGTAGCTGCATGATGAAGG + Intergenic
1023664524 7:42508924-42508946 AGCAATTAGATAAATGTAGAGGG + Intergenic
1025833523 7:65075253-65075275 AGCAAGAAGTTGAAAGCACAAGG - Intergenic
1025903283 7:65764762-65764784 AGCAAGAAGTTGAAAGCACAAGG - Intergenic
1027798520 7:82723134-82723156 AGCAAGCTGCTGTATGCAGAGGG + Intergenic
1030404159 7:109089321-109089343 AGCAGGCAGAAGAATGCAGAAGG - Intergenic
1031598831 7:123679042-123679064 AGCAAGGATGTGAATGCATAAGG - Intergenic
1034530803 7:151695325-151695347 ATCAAGTAGCTTTATTCAGAAGG - Intronic
1035766340 8:2108853-2108875 AGCCAGCAGCTGCAAGCAGAGGG - Intronic
1039431726 8:37530060-37530082 GGAAAGTGTCTGAATGCAGATGG - Intergenic
1041169252 8:55124236-55124258 AGCAAGTAGATGAATGGCCAAGG - Intronic
1045287542 8:100804990-100805012 AGGATGTAGCTGAATGCGTATGG + Intergenic
1046105372 8:109658993-109659015 GCCAAGCAGGTGAATGCAGAAGG - Intronic
1047499912 8:125432468-125432490 AGATAATAGCTGAATCCAGATGG + Intronic
1048121943 8:131591374-131591396 AGGAAGTAGCTGAACTCAGGAGG - Intergenic
1051759647 9:20448124-20448146 AGAAAGTTGCTGAAGGCAGGAGG - Exonic
1051878333 9:21813694-21813716 AGCTAGTAGCTGAATCCCCAGGG + Intronic
1052511095 9:29421667-29421689 AGCAGGAAGCTGTATGCAAATGG - Intergenic
1055369746 9:75584426-75584448 ACTCAGTAGCTGAAGGCAGATGG + Intergenic
1056169118 9:83965767-83965789 AGCTAGTGGCTGGATACAGATGG - Intergenic
1057292562 9:93815982-93816004 AGCAAAAAGCTGTATGCATATGG - Intergenic
1058816227 9:108684956-108684978 AGTAAGTGGCAGATTGCAGATGG - Intergenic
1058978915 9:110151171-110151193 AGTAAGTAAATGAATACAGAAGG - Intronic
1058978918 9:110151209-110151231 AGTAAGTAAATGAATACAGAAGG - Intronic
1186015276 X:5184323-5184345 TGTAAGTAGATGAATGCAGATGG + Intergenic
1186565315 X:10655943-10655965 AGCAATTAGCTGGATTCAGCTGG - Intronic
1187211588 X:17237384-17237406 AGCAAGAATGTGAATGCAGGTGG - Intergenic
1188046412 X:25430253-25430275 AACAACTAGCTGAATGAAGTTGG + Intergenic
1188475219 X:30584999-30585021 AACAAATACCTGAATGCTGAAGG + Intergenic
1188720145 X:33512716-33512738 AGAAAGTATGTGAATGGAGATGG + Intergenic
1188842769 X:35036843-35036865 GGAAAGAAGCTGAATGCAGGGGG + Intergenic
1189346717 X:40247497-40247519 AGCCAGGATCTGAATCCAGATGG - Intergenic
1189630666 X:42949258-42949280 AGCCAGTAGCTGAATGGCAAAGG + Intergenic
1193348119 X:80428172-80428194 AGAAAGTGGCTGCATTCAGACGG + Intronic
1195765481 X:108292360-108292382 AGGAAATAGCTGAAGGCGGAAGG - Intronic
1196459657 X:115917227-115917249 GGCAAGTAGTTGAAGGCATAGGG - Intergenic
1197464669 X:126788480-126788502 ATCAAGAAGCTAAAAGCAGATGG - Intergenic
1198617128 X:138471192-138471214 AGGAAGTGGCTGAATACAAAGGG + Intergenic
1201188901 Y:11430011-11430033 CGCAAGGAGCTGAAGGCAGCGGG + Intergenic