ID: 1124098107

View in Genome Browser
Species Human (GRCh38)
Location 15:26668095-26668117
Sequence TTGCTACTTCCTTATAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124098106_1124098107 2 Left 1124098106 15:26668070-26668092 CCAGACAAGAGTCAGAGTCTCAG 0: 1
1: 0
2: 3
3: 13
4: 177
Right 1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
1124098104_1124098107 21 Left 1124098104 15:26668051-26668073 CCACAGTTGCTGGAGTCACCCAG 0: 1
1: 0
2: 2
3: 24
4: 179
Right 1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
1124098105_1124098107 3 Left 1124098105 15:26668069-26668091 CCCAGACAAGAGTCAGAGTCTCA 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124098107 Original CRISPR TTGCTACTTCCTTATAATGC AGG Intronic
901062697 1:6480040-6480062 TTGCTATTTGCCTGTAATGCTGG + Intronic
904882791 1:33713483-33713505 TTGCTCAATCCTTATAATGTAGG - Intronic
908923302 1:69222452-69222474 TTGCAACTTCCTAAACATGCCGG + Intergenic
909517713 1:76531237-76531259 TTGCCCCTTCCTTAAAAAGCAGG + Intronic
913235759 1:116781703-116781725 TTGCCATTTCCTTACATTGCTGG - Intergenic
913976842 1:143466011-143466033 TTGCTGTTTCATTATAATGTGGG - Intergenic
914071244 1:144291638-144291660 TTGCTGTTTCATTATAATGTGGG - Intergenic
914107911 1:144674717-144674739 TTGCTGTTTCATTATAATGTGGG + Intergenic
917901737 1:179549529-179549551 TTCATACTTCCTTATAACACTGG - Intronic
920556939 1:206910727-206910749 GGGCTAGTTCCTTATAATGGTGG + Intronic
921968780 1:221121839-221121861 TTTCTCCTTACTTATAGTGCAGG + Intergenic
923098103 1:230791728-230791750 TGGCTACTCTCTTATGATGCTGG - Intronic
923119041 1:230973385-230973407 TAGCTACTTCCTTATTTTTCTGG + Intronic
924556794 1:245125564-245125586 TTGCTTCTGCCTTCTAAGGCAGG - Intronic
1063072832 10:2683878-2683900 ATGGTAAATCCTTATAATGCTGG + Intergenic
1065808642 10:29420478-29420500 TTGCTTCTTCCAGACAATGCAGG + Intergenic
1067185325 10:44022310-44022332 AGGGTACTTCCTTATTATGCTGG + Intergenic
1071343069 10:84666028-84666050 TTGCCCCTTCTTTATTATGCTGG + Intergenic
1075503258 10:122997590-122997612 TGGGTACGGCCTTATAATGCAGG - Intronic
1082746882 11:56973019-56973041 TTGCTCATTCATTATAATGTTGG - Intergenic
1083574372 11:63779081-63779103 TTTCTTCTTCCTTGGAATGCTGG - Intergenic
1084896986 11:72279795-72279817 TTTCTAGTTCCTTAAATTGCAGG + Intergenic
1085855326 11:80169627-80169649 ATACTACTTCCTTAGAAAGCTGG - Intergenic
1088511934 11:110585592-110585614 TTCTTACTCTCTTATAATGCAGG + Intronic
1090276703 11:125425178-125425200 TTGCTACTTCCATCTAAGGATGG + Intronic
1091566186 12:1649906-1649928 TTGCTAGTTCCTAAAACTGCAGG - Intergenic
1092503346 12:9069439-9069461 GGGCTACTTCCTTATATTACTGG + Intronic
1092963422 12:13617915-13617937 TTACTGCATCATTATAATGCAGG + Intronic
1094820703 12:34222042-34222064 TTGCTACATTCTCATAATGATGG - Intergenic
1095933269 12:47650525-47650547 GTGCTACTTCATCATAATTCAGG + Intergenic
1097301692 12:58026070-58026092 AGGTTACTTCCTTATCATGCTGG + Intergenic
1099354913 12:81622004-81622026 TTGCTACTTCCTTATTTTTCTGG - Intronic
1100121548 12:91374656-91374678 TTACAAGTTCCTCATAATGCAGG - Intergenic
1105222387 13:18343798-18343820 TTGCTGTTTCATTATAATGTGGG + Intergenic
1107996762 13:45868788-45868810 ATGCTATTTCTTGATAATGCTGG + Intergenic
1108911833 13:55563661-55563683 TTTCTAATTCCTTTTAATACTGG + Intergenic
1111684179 13:91481767-91481789 TTGCTACTTGGTTCCAATGCTGG - Intronic
1111798523 13:92954358-92954380 TTGCTGCTTCATTAATATGCTGG + Intergenic
1112907896 13:104446659-104446681 TAGCTAATTCCTTATCATGTGGG + Intergenic
1113469972 13:110537338-110537360 TTGCTTATTCCTTATACTGGTGG - Intronic
1117100629 14:52342937-52342959 TTACTACTGCCTTCTAATTCTGG - Intergenic
1117126580 14:52634115-52634137 ATGGTAGTTCCTGATAATGCAGG - Intronic
1117302381 14:54442294-54442316 TTGCTACTTGTTTTTAATGCTGG + Intergenic
1117678142 14:58175954-58175976 TTGCAACTTTCTTATAAGTCTGG + Intronic
1118790062 14:69082759-69082781 ATGTTACTTCCTCAGAATGCTGG - Intronic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG + Intronic
1124142013 15:27085722-27085744 TTGCTACCTCCCTCCAATGCAGG - Intronic
1125765141 15:42130622-42130644 AAGCTACTTCCTTATGGTGCAGG - Intergenic
1128970829 15:72104130-72104152 ATGATACTTTCTCATAATGCTGG + Intronic
1132535088 16:474933-474955 TTCCTACTTGCTTGTCATGCTGG - Intronic
1132841880 16:1982046-1982068 TGGCTGCTTCCTTATAGTTCGGG + Exonic
1135157870 16:20069745-20069767 CTGCTCCTTCCTTATCAAGCTGG + Intronic
1137837017 16:51602039-51602061 TTTGTACTTCCTGATAATTCTGG + Intergenic
1141102090 16:81205077-81205099 TTGCTCTTGCCTTATAATTCTGG + Intergenic
1143507987 17:7380114-7380136 TTCCTCCTTGCTTATAATGTGGG - Intergenic
1143508285 17:7381400-7381422 TTCCTCCTTGCTTATAATGTAGG + Intronic
1143977753 17:10842914-10842936 TTGCTTCTCCCTTGTGATGCTGG + Intergenic
1151058093 17:71057289-71057311 TTTTTACTTCCTTAAAATGGCGG + Intergenic
1156428838 18:37047973-37047995 ATACTACTCCCTTATAATGCTGG + Intronic
1157589389 18:48827244-48827266 ATGCTACTTCCTTATTAAACTGG + Intronic
1164535142 19:29080285-29080307 TTGCTTCTTCCTTTTCATCCCGG - Intergenic
1164694563 19:30233695-30233717 TTACACCTTCCTTATGATGCAGG + Intronic
1164924239 19:32114801-32114823 TTGCTATTTCCTAAGAATGAGGG - Intergenic
1166241262 19:41496066-41496088 TTTCTATTTCCTGTTAATGCAGG + Intergenic
925593652 2:5534387-5534409 TTTCTTCTTCCTTATAATTGAGG - Intergenic
925668440 2:6287088-6287110 TTGCAACTTCCTTAATATACTGG - Intergenic
928104962 2:28464047-28464069 TTACTTCTTCCTCATCATGCTGG - Intronic
934291846 2:91701215-91701237 TTGCTGTTTCATTATAATGTGGG - Intergenic
938170086 2:129068493-129068515 TTGCTATTTCCTTCTCTTGCAGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941002033 2:160212095-160212117 CTGCTGCTTTCTTATGATGCAGG + Intronic
943622194 2:190161451-190161473 TTGCTACTTGTTTAGAATGTGGG - Intronic
945189644 2:207173749-207173771 TTGCTGCTTCCTTCTAACTCAGG + Intergenic
1169864290 20:10183535-10183557 TTTATACTTTCTTATTATGCAGG - Intergenic
1173590887 20:44223899-44223921 TTGCTATTTCTTTACAAGGCAGG + Intergenic
1176730935 21:10496222-10496244 TTGCTGTTTCATTATAATGTGGG + Intergenic
1176916562 21:14632885-14632907 TTCCTAGTTCCTTATCATGCAGG + Intronic
1177097650 21:16857808-16857830 TTGCAACTACTTTATAATGTAGG + Intergenic
1177506117 21:22019308-22019330 TTGTTACTTTTTTATAATACTGG - Intergenic
1183122894 22:35744591-35744613 TTGATACAGCCTTATAATCCTGG + Intronic
1203289768 22_KI270735v1_random:24365-24387 TTGATACTACCTTAAAATGGAGG - Intergenic
950260388 3:11539130-11539152 TTGTTACTTGCTTACAATGATGG - Intronic
953211595 3:40880077-40880099 TTCTTTCTTCCTTATAATGTTGG - Intergenic
955876846 3:63499543-63499565 TTTCTGCTTCCTTATAATTTTGG - Intronic
957768075 3:84651690-84651712 TTGCTAGTTCCATATAATTGTGG - Intergenic
958465005 3:94446793-94446815 TTGCCAATTCAGTATAATGCTGG - Intergenic
958589828 3:96142061-96142083 TTCCTACTTTCTTATAAATCAGG - Intergenic
959027734 3:101260145-101260167 TGGCTGCTTCCTTATATGGCAGG - Intronic
960179379 3:114557117-114557139 CTGCTACTTCCTAATAAAACTGG - Intronic
960542717 3:118879361-118879383 TTGTTGCTTACTTATATTGCAGG - Intergenic
961335025 3:126170639-126170661 TAGCTACTTCCTGCTGATGCGGG - Intronic
961347228 3:126271595-126271617 TTTCTACTTCTTGATAATACGGG + Intergenic
962260885 3:133904661-133904683 TTTCTACTTTCTTATAGTGGAGG + Intergenic
964275927 3:155008922-155008944 TAGCTACACCCTTAGAATGCTGG + Intergenic
964367515 3:155965876-155965898 TGGCTACTTCCTTCTAAGTCTGG - Intergenic
964782231 3:160352865-160352887 CTGCTACTTCCCTATTATTCAGG + Intronic
967879121 3:194286824-194286846 TTGTTACTTCTTTATTATCCGGG + Intergenic
970281660 4:14463434-14463456 TTGCTTCTTCCTTATGAGGCTGG + Intergenic
971787070 4:31118216-31118238 TAGCTACTTTCTTACAATGCTGG - Intronic
972052092 4:34749659-34749681 TTGAAACTTCCTTACAATTCCGG + Intergenic
972710986 4:41594639-41594661 TTGCTACAACCTAATGATGCTGG - Intronic
973083416 4:46024336-46024358 ATGTTACTTCTTTATAATCCTGG - Intergenic
974070921 4:57122831-57122853 TTGGAAATTCCTTATAATTCTGG + Intergenic
974483929 4:62482140-62482162 TTGATATTTCCTTATAAGGAGGG + Intergenic
974721679 4:65747889-65747911 TTTCTCCTTCCTTAAAATGTTGG - Intergenic
975811506 4:78175070-78175092 TTGCTACTTCCTGCAAATGCAGG + Intronic
979227707 4:118308275-118308297 TTATTACTTCTTTATAATTCTGG + Intronic
979738196 4:124116062-124116084 TTACTACTTTCTTATCATTCTGG + Intergenic
983814248 4:172103261-172103283 TAGCTACTTCCTAAAAATTCTGG - Intronic
985395636 4:189540663-189540685 TTGCTAGTTCAGTATAATGTTGG - Intergenic
988351876 5:30119002-30119024 ATGTTATTTCCTTGTAATGCTGG + Intergenic
989636115 5:43536138-43536160 TTCCTACATCCTTATAGTGATGG - Intronic
994536456 5:101036847-101036869 TTTCTCTTTCTTTATAATGCTGG - Intergenic
996417798 5:123228751-123228773 TTGCTGCTTCATTCTGATGCAGG + Intergenic
997430094 5:133831654-133831676 TTCCTACTTCCTTATGGTTCTGG - Intergenic
1000889439 5:166785516-166785538 TGGTTTCTTCCTTCTAATGCTGG - Intergenic
1006230597 6:32583391-32583413 TTACTATTTTATTATAATGCTGG - Intronic
1007698985 6:43754600-43754622 TTGATACTTCCTTATATACCAGG - Intergenic
1008624387 6:53303463-53303485 TTGTTACTTCCTTAGAATGGAGG - Intronic
1011149724 6:84257696-84257718 ATCCTATCTCCTTATAATGCTGG + Intergenic
1013047754 6:106504483-106504505 TAGCTACTTCTTTATGATTCTGG - Intergenic
1014811030 6:125885907-125885929 TTACTTTTGCCTTATAATGCTGG + Intronic
1020161725 7:5778251-5778273 TTGCTCCTTCCTTCCACTGCAGG + Intronic
1020764153 7:12300092-12300114 AGGTTACTTCCTTATCATGCTGG - Intergenic
1023153892 7:37228483-37228505 TTGCTTCTTCCTTATGTTACAGG - Intronic
1024338732 7:48236089-48236111 TGGCTGCTTCCTTAAAATACAGG - Intronic
1026494515 7:70890826-70890848 TTAGTACTTCCTTATGATGCAGG - Intergenic
1027196466 7:76033969-76033991 TTGCCACTTCTATATAATGAGGG + Intronic
1033278491 7:139989865-139989887 TTGTCTCTTCCTTATAAGGCAGG - Intronic
1033661291 7:143404923-143404945 TTTCTACTCCATTATAATGCAGG + Intronic
1035433184 7:158837807-158837829 TTCCTAATTGCTTATAATTCAGG + Intergenic
1035639595 8:1174184-1174206 TTCCTTCTTCCTTAGAATCCTGG - Intergenic
1042745669 8:72103152-72103174 TTGCTGCTTCCTTATACTCTGGG + Intronic
1044698268 8:94944432-94944454 TTGCTACTTGCATATATTCCAGG - Intronic
1045003430 8:97897420-97897442 TTGCCAATTCCCTATAAGGCTGG - Intronic
1045758270 8:105571639-105571661 ATGCTAAGTCCTCATAATGCTGG - Intronic
1045930201 8:107614541-107614563 TTTTTTCTTCCTTATAAAGCAGG + Intergenic
1046569164 8:115940984-115941006 TTTCTGCTTCCTTGTAATTCTGG + Intergenic
1048750639 8:137669966-137669988 TTGCTACTTCTGGATAATGATGG - Intergenic
1050674364 9:8035685-8035707 TTGCAACTTTCATATATTGCTGG + Intergenic
1053216517 9:36275170-36275192 TTTCTTCTTCCTTATAAACCTGG + Intronic
1055887273 9:81078445-81078467 TTGCAGCTACCTTATAATGTAGG + Intergenic
1059538404 9:115106042-115106064 TCTCTACTTCCTTCTAATACAGG - Intronic
1188850178 X:35122531-35122553 TTCCTACTTATTTACAATGCTGG - Intergenic
1192710195 X:73574033-73574055 TTGCTTCTTCGGTATAATGGTGG + Intronic
1194045994 X:89004051-89004073 TAGCTACATCCATATAAGGCAGG + Intergenic
1196232788 X:113243660-113243682 TTCCTACTTCCTTATAAGACAGG - Intergenic
1196336858 X:114547178-114547200 TTGTTACTTCCTTTTAAGGGAGG + Intergenic
1200822585 Y:7602206-7602228 TGGCTACTTCCTGCTGATGCGGG + Intergenic
1202237718 Y:22731811-22731833 TGGCTACTTCCTGCTGATGCAGG - Intergenic