ID: 1124101406

View in Genome Browser
Species Human (GRCh38)
Location 15:26697554-26697576
Sequence CCTCAGATAATGCAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124101395_1124101406 29 Left 1124101395 15:26697502-26697524 CCACCCTGGCACACTCTCTCAGG 0: 1
1: 0
2: 3
3: 38
4: 304
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1124101398_1124101406 25 Left 1124101398 15:26697506-26697528 CCTGGCACACTCTCTCAGGTCCT 0: 1
1: 0
2: 2
3: 24
4: 265
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1124101401_1124101406 -6 Left 1124101401 15:26697537-26697559 CCTCCAGTGAAGCAGGACCTCAG 0: 1
1: 0
2: 1
3: 19
4: 186
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1124101397_1124101406 26 Left 1124101397 15:26697505-26697527 CCCTGGCACACTCTCTCAGGTCC 0: 1
1: 0
2: 2
3: 20
4: 242
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1124101402_1124101406 -9 Left 1124101402 15:26697540-26697562 CCAGTGAAGCAGGACCTCAGATA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1124101399_1124101406 5 Left 1124101399 15:26697526-26697548 CCTTCTCAAGTCCTCCAGTGAAG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124101406 Original CRISPR CCTCAGATAATGCAGGAAGA GGG Intronic
900403366 1:2482005-2482027 CCTAAGATAAGGCTGGAAGTGGG + Intronic
900609336 1:3537856-3537878 TCCCAGCTAATGCAGGGAGAGGG + Intronic
900696390 1:4013891-4013913 CATGGGATAATGCAGCAAGAAGG - Intergenic
900963805 1:5943642-5943664 GCCCAGCTCATGCAGGAAGACGG + Intronic
901000888 1:6148282-6148304 CCTCAGTTTCTACAGGAAGAGGG - Intronic
902123714 1:14190580-14190602 GCTAAGATAATGCAGTAAAAAGG + Intergenic
902607444 1:17576451-17576473 GCTCAGACAAGGGAGGAAGAGGG - Intronic
902848810 1:19136383-19136405 CCTCATATTATTCAGGAAGAAGG + Intronic
903210830 1:21817274-21817296 CCTCTGACAACACAGGAAGAAGG + Intronic
904397736 1:30233816-30233838 TCTCAGCTAATGCAGGATGTAGG - Intergenic
904644550 1:31956025-31956047 CATTAGATATTGAAGGAAGAAGG - Intergenic
904828872 1:33294198-33294220 CATCAGATAATGCATGTAAAGGG - Intronic
904978885 1:34479987-34480009 CATCAGTTAGTGCAGGCAGAGGG + Intergenic
905734372 1:40315693-40315715 CCTCAGACAGTGCAGGAAGCTGG + Intronic
906685136 1:47758373-47758395 CCTCAGAGAATGCAGAAAGATGG + Intergenic
906844346 1:49175061-49175083 CCTGAGATAATGAAGGAATTTGG - Intronic
909966444 1:81917273-81917295 CCTCAGATAATGTACAAAGTAGG - Intronic
911309245 1:96273170-96273192 CCTCAGAAAAAGCACAAAGAAGG + Intergenic
912975431 1:114324947-114324969 ACTCTAATAATGCAGGCAGAGGG + Intergenic
915445647 1:155973254-155973276 GCTCTGATAAGGAAGGAAGAGGG - Intronic
916306473 1:163340358-163340380 CCTTAGATAGTGCTGCAAGAGGG + Exonic
917352251 1:174090469-174090491 CCACACCTAATGCAGGAAGATGG - Intergenic
917673167 1:177293315-177293337 CATAGGATAATGCAGCAAGAAGG - Intergenic
917927718 1:179803098-179803120 CCTCAGGCAAGGCTGGAAGAAGG - Intronic
918138068 1:181694588-181694610 CATGAGATGATGCAGCAAGAAGG + Intronic
921369028 1:214402866-214402888 CCACAGGTAAGGCAGGCAGAGGG - Exonic
922145835 1:222943260-222943282 CCACGGATGATGCAGGCAGAAGG - Exonic
922641552 1:227237157-227237179 CCCCAGATAATAGAAGAAGAAGG - Intronic
923404182 1:233644128-233644150 CATGTGAGAATGCAGGAAGAAGG - Intronic
924625590 1:245694624-245694646 CCGCAGATGATACCGGAAGATGG + Intronic
1062991195 10:1820850-1820872 GTTCAGATAATCCAGGATGATGG - Intergenic
1063110273 10:3029604-3029626 CCGCAGATAATAGAGGGAGAAGG + Intergenic
1064144592 10:12817613-12817635 CCGGAGATAATGCATGTAGAGGG + Intronic
1067176679 10:43954859-43954881 CCTGAGGTAAGGCAGGAAGAAGG + Intergenic
1068117843 10:52753449-52753471 CATCAGAACATACAGGAAGAAGG + Intergenic
1068941162 10:62682819-62682841 ACCCAGATAATGCAGCAAGTGGG - Intergenic
1069604754 10:69732177-69732199 CTTCAGTGCATGCAGGAAGAAGG + Intergenic
1070364241 10:75720799-75720821 CCTCTGACAATGCAGGAAGTTGG + Intronic
1070493078 10:76995578-76995600 CCTGAGATAGTGGAGGAGGATGG + Intronic
1070696690 10:78569268-78569290 CCCCAGATGTTGCAGGAAGGAGG + Intergenic
1072837419 10:98730910-98730932 ACTCAGAAAATGGAGGAAGAGGG + Intronic
1072932665 10:99680387-99680409 CTTCCTCTAATGCAGGAAGAGGG - Intronic
1073032897 10:100542047-100542069 TATCAGATACTGCAGGAAAAAGG + Intronic
1074409396 10:113212303-113212325 CATGGGATAATGCAGTAAGAAGG + Intergenic
1074423590 10:113331007-113331029 CCTGGGATGATGCAGCAAGAAGG - Intergenic
1074740412 10:116480792-116480814 CATCAGTTAAAGCAGGAACAGGG - Intergenic
1075409301 10:122215559-122215581 CCACACAGAATGCAAGAAGAGGG - Intronic
1075820552 10:125304876-125304898 CCTTAGATGATGCAGTAGGATGG - Intergenic
1076040742 10:127246068-127246090 CATCAGAGAAAGCTGGAAGAGGG - Intronic
1078714319 11:13825571-13825593 CCTCAGCAAATGGAGGCAGAAGG + Intergenic
1078732133 11:13984444-13984466 CATGGGATAATGCAGCAAGAAGG - Intronic
1079184487 11:18224191-18224213 GGTCAGATCATGCAGGAACAAGG + Intronic
1079649381 11:22908008-22908030 CATGGGATAATGCAGCAAGAAGG + Intergenic
1080501497 11:32875504-32875526 CCTGAGATGATGCAGCAAGAAGG + Intergenic
1083192448 11:61062000-61062022 CAACAGATAATGCAGTGAGATGG + Intergenic
1086898973 11:92344853-92344875 CCTCAGATAAGGCTGGGGGAGGG + Intergenic
1087752482 11:102021508-102021530 TATGAGATAATGCAGCAAGAAGG + Intergenic
1087970910 11:104482081-104482103 TTTCAGAAAATACAGGAAGAGGG + Intergenic
1088393262 11:109339483-109339505 CCTCACATAATGAAGAAAGATGG - Intergenic
1090381125 11:126328430-126328452 CCTCAGGAAAGGCAGGAGGATGG + Intronic
1090527386 11:127552093-127552115 CCTTAGATATTGCTGTAAGAAGG - Intergenic
1091293521 11:134456133-134456155 CCTCCTAAAATGCAGGTAGATGG - Intergenic
1091700197 12:2654021-2654043 CCTCAGAAAATGGAAGAGGAGGG - Intronic
1092188900 12:6503393-6503415 CCTGTGACAATGCAGCAAGAAGG - Intronic
1092385831 12:8034845-8034867 CTTCAGAAAAGGCAGGAAAAGGG + Intronic
1093845691 12:23968566-23968588 CCTGAGATGACACAGGAAGAAGG + Intergenic
1094064023 12:26344096-26344118 CCTATGATGATGCAGCAAGAAGG + Intronic
1094376907 12:29800364-29800386 CCTCAGCTAATGATGAAAGAGGG + Intergenic
1094595318 12:31860298-31860320 CCTTACATAATGCACCAAGAAGG + Intergenic
1095202142 12:39396521-39396543 CCTCAGATAATGAATTAAAATGG + Intronic
1095284711 12:40395113-40395135 GCTAAGATAATTCATGAAGATGG - Intronic
1095602277 12:44027624-44027646 CTTCATGTAATGCAGTAAGAAGG - Intronic
1096592592 12:52670984-52671006 CATCAGATAACTCAGGAAGAAGG - Intergenic
1096638352 12:52975482-52975504 CCTCAGAGAATGCAGACAGAAGG - Intergenic
1098841640 12:75484769-75484791 CATCAGTTAAGGCAGGAACAGGG + Intronic
1099344284 12:81478798-81478820 CCTCAGATAATGCAAAAGAAAGG - Intronic
1101436889 12:104671789-104671811 TCTCACATTATGCAAGAAGAGGG - Intronic
1101835135 12:108289651-108289673 CCTCAGTAAATGTGGGAAGAGGG + Exonic
1102655542 12:114479908-114479930 CCTCAGGTATTCCAGGAAGCCGG - Intergenic
1103014492 12:117483138-117483160 CCTAAGATAAGGCAGTAAGTAGG - Intronic
1104675820 12:130711292-130711314 CCTCAGAAAATGGAGGAAATTGG - Intronic
1104904846 12:132207654-132207676 CCTCAGCTAATGATGGAAGTTGG - Intronic
1105288676 13:19030607-19030629 GCTGAGATAATTCATGAAGATGG - Intergenic
1107407494 13:40128223-40128245 GATGAGATAATGCAGGTAGAAGG - Intergenic
1109687159 13:65835912-65835934 ACTCAGATAATACAGGTGGATGG + Intergenic
1110002592 13:70223869-70223891 CCATAGACAATACAGGAAGAAGG - Intergenic
1110134903 13:72054638-72054660 CATAATATAATGCAGCAAGAAGG - Intergenic
1110908957 13:80931260-80931282 CCTTAGATAAGGCAGAAAGTAGG + Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1111730588 13:92071516-92071538 CAGCAGATAATGCAGGAACCAGG - Intronic
1111876687 13:93905852-93905874 CCTGAGATAAAGTATGAAGAAGG + Intronic
1112286355 13:98107854-98107876 CATGTGATAATGCAGCAAGAAGG + Intergenic
1112808933 13:103194931-103194953 CCACAGGTCATGCTGGAAGATGG - Intergenic
1112885583 13:104167123-104167145 CATGAGAGAATGCAGCAAGAAGG - Intergenic
1114734862 14:25033920-25033942 CCTGAGAAAATGCAGGTATATGG + Intronic
1114795427 14:25710123-25710145 CATGAGATCATGCAGCAAGAAGG - Intergenic
1115940064 14:38599189-38599211 CCTCAGCAAATGCAAGAAAATGG - Intergenic
1116150596 14:41136768-41136790 ACTGAGATAATGGAGGAAGGTGG - Intergenic
1116313505 14:43357228-43357250 CCTCAGAGAATGGAGGAAATTGG + Intergenic
1119544372 14:75460963-75460985 CCTAGGATGATGCAGCAAGAAGG - Intronic
1121169207 14:91838843-91838865 CCTCAGATAGAACAGGAAGGAGG - Intronic
1123996498 15:25721411-25721433 CCCCAGACACTGCAGGAACAGGG + Intronic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1124120225 15:26882743-26882765 CATCAGACAATTCAGGATGAGGG - Intronic
1125405692 15:39350923-39350945 TCTCTGAGAAGGCAGGAAGAGGG - Intergenic
1126039853 15:44579221-44579243 CATAAGAAAAAGCAGGAAGAGGG + Intronic
1126690928 15:51288480-51288502 CCTTAGATAAAGCAGGAACGCGG - Intronic
1126765198 15:52004631-52004653 CATGAGATGATGCAGCAAGAAGG - Intronic
1127729200 15:61783054-61783076 CATCAAATCATGCAGGAAAAAGG - Intergenic
1127992105 15:64127268-64127290 CCTCACATTATTCAGGAAAATGG - Intronic
1129655612 15:77523381-77523403 CCTGAGATGATGCACGAAGAAGG + Intergenic
1131718632 15:95142430-95142452 CCTCTGATCATGGAGGTAGATGG - Intergenic
1132879595 16:2156105-2156127 TCTCGGGGAATGCAGGAAGAAGG - Intronic
1133028320 16:2998152-2998174 CCTTGGAGAAGGCAGGAAGAGGG - Intergenic
1134473442 16:14549046-14549068 GCTGAGATAAGGCAGGAAGGAGG + Intronic
1135536746 16:23300725-23300747 TCCCAGCTAAGGCAGGAAGATGG + Intronic
1138680445 16:58680138-58680160 CCACAGACCTTGCAGGAAGAAGG - Exonic
1139476107 16:67203313-67203335 CCACAGGGACTGCAGGAAGAAGG - Exonic
1139517027 16:67458242-67458264 CCTCAGAGAGAGCAGGAAGCTGG - Intronic
1140269192 16:73447711-73447733 TCTCAGGTAAAGCAGGAAGTTGG + Intergenic
1141920130 16:87130066-87130088 CCTTACACAAGGCAGGAAGAGGG - Intronic
1142178450 16:88655811-88655833 CCTCAGCCAATGCAGGCAGCGGG + Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1145717525 17:27036118-27036140 GCTGAGATAATTCATGAAGATGG - Intergenic
1147616487 17:41831654-41831676 AATGAGATAATGCAGCAAGAAGG + Intronic
1148906220 17:50914049-50914071 CCTCTGATGAGGGAGGAAGAAGG + Intergenic
1149542141 17:57475482-57475504 CCTCAGATAAAGCAAGAGGGAGG - Intronic
1150285068 17:63949799-63949821 CCTCAGATAAGGGAGGAGGCGGG + Intronic
1151163331 17:72184041-72184063 CCTGAGAAAAGGCAGGAGGAGGG + Intergenic
1151497293 17:74466530-74466552 GGTCAGAAAATGCAGGAAGCTGG - Exonic
1152311049 17:79550056-79550078 CCTCAGAAAATGGAGGAAGATGG - Intergenic
1153580015 18:6563298-6563320 CCTAAGATAATTCACGGAGAAGG - Intronic
1154471055 18:14702025-14702047 GCTGAGATAATTCATGAAGATGG + Intergenic
1155060547 18:22224367-22224389 CTCCAGTTAATGCAGAAAGAAGG + Intergenic
1155073310 18:22334742-22334764 CATTAGATAATGCAGGATGATGG + Intergenic
1155709572 18:28859276-28859298 CATGAGATAATGCAGCAATAAGG + Intergenic
1158014551 18:52768339-52768361 CCTCAGAAATTGCAGGGAGAAGG + Intronic
1158440360 18:57469737-57469759 CCTTAGAGAAAGCAGAAAGAAGG - Intronic
1160178841 18:76617401-76617423 CCACAGGTAATGCAGAATGATGG + Intergenic
1160275813 18:77434140-77434162 CCTCAGATTATAGATGAAGAAGG - Intergenic
1163803869 19:19384816-19384838 CCTCAGATAAAGGAGGGACAGGG + Intergenic
1165580682 19:36860665-36860687 CCTGAGATGATGCAGCAAGAAGG - Intronic
925019921 2:560365-560387 CCTCAGGTACTGCAAGGAGAAGG - Intergenic
925767714 2:7252918-7252940 CCTCTGAGGATGCAGGAGGAAGG + Intergenic
925779720 2:7370870-7370892 CCTTAGATAATGGAAGCAGAGGG - Intergenic
925902703 2:8519804-8519826 GGTCAGGTACTGCAGGAAGAGGG - Intergenic
926372506 2:12194136-12194158 CATAAGATGATGCAGAAAGAAGG + Intergenic
926384441 2:12322496-12322518 CATCACACAATGCATGAAGAAGG - Intergenic
926489483 2:13506406-13506428 CCTTGGATGATGCAGGAACAAGG - Intergenic
927015821 2:18960782-18960804 CGTCAAATAAGGCAGCAAGAAGG - Intergenic
927118642 2:19930472-19930494 TCACAGATAATGCATGGAGAGGG - Exonic
933041510 2:77473162-77473184 ACTCAGACAATCCAGGAAGACGG - Intronic
933545882 2:83711388-83711410 CATGAGATAAGGAAGGAAGATGG - Intergenic
934550867 2:95260789-95260811 CCTCCCATCATGCAGGAAGCAGG - Intergenic
936625160 2:114140937-114140959 CATGAGATAATGCAAGTAGACGG + Intergenic
937577082 2:123436849-123436871 CCACAGATAAATAAGGAAGATGG - Intergenic
937725720 2:125163526-125163548 CCCCAGATAATGAAGGCACACGG - Intergenic
938078791 2:128358102-128358124 CCTCTGAAAAAGCTGGAAGATGG - Intergenic
938927515 2:136057827-136057849 CCATGGATAATGCAGCAAGAAGG - Intergenic
939610012 2:144298667-144298689 GCTCAGAAAACTCAGGAAGATGG - Intronic
941750259 2:169128071-169128093 CCTCAGATAATACAGAAGGTAGG - Exonic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
943441683 2:187933930-187933952 CCTCAAATAAGGGAGAAAGAGGG + Intergenic
943943472 2:194028901-194028923 CCACAGATAGTGTAGGCAGATGG + Intergenic
944772788 2:202931470-202931492 CCTCAAACAATGCAGGAATTGGG - Intronic
944892677 2:204134008-204134030 CCTCAAATCATTCAGGAAAAAGG - Intergenic
945314021 2:208350999-208351021 CCTCAGAAAATGCAGCAGGAAGG + Intronic
946531221 2:220572384-220572406 CATCAGTTAATGCATGCAGATGG + Intergenic
946809959 2:223513110-223513132 CCTCAGGTAGTGCTGAAAGAAGG - Intergenic
1169301443 20:4445179-4445201 CATCTGATGATGCAGCAAGAAGG + Intergenic
1170708225 20:18765421-18765443 CCTCACAGTATGCAGGAACATGG + Intergenic
1170962956 20:21041643-21041665 CCTCAGGAAATGAAGGGAGAGGG + Intergenic
1172900884 20:38334073-38334095 TCTCAGACACTGCAGTAAGAGGG - Intronic
1173234042 20:41227470-41227492 ACTCACATATTGCAGGAGGAAGG - Intronic
1173632171 20:44524882-44524904 CATCAGTTAAGGCAGGAACAGGG - Intergenic
1174721931 20:52822072-52822094 CTTCAGACAAAGCAGGCAGAAGG + Intergenic
1175012436 20:55753229-55753251 CATGTGATGATGCAGGAAGAAGG - Intergenic
1175356265 20:58371121-58371143 CCTCAGATACTGCTGTTAGAGGG + Intergenic
1175411763 20:58774930-58774952 CCACACATCATGCAGTAAGATGG - Intergenic
1175560648 20:59926347-59926369 CCTCTGAAAGTGCTGGAAGAAGG + Intronic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1176664331 21:9670601-9670623 CCCCAGAGAAGGAAGGAAGAGGG - Intergenic
1183259954 22:36788239-36788261 CCTCAGATCATCCTGGCAGAGGG + Intergenic
951126526 3:18991005-18991027 CCTAAGAGAATGAAGGAGGAAGG - Intergenic
952313441 3:32211315-32211337 CATGAGATGATGCAGCAAGAAGG + Intergenic
952691869 3:36217838-36217860 CATCTGATAATGCATGAAAACGG + Intergenic
954570571 3:51637522-51637544 CCTCTGAAAATTCAGGAAGCAGG - Intronic
954946021 3:54425008-54425030 CCTCAGCTAGTGAAGGAACATGG + Intronic
955050152 3:55402585-55402607 CCTCAGGTGAAGTAGGAAGAGGG - Intergenic
955550369 3:60078318-60078340 CCTGATATAATGCACTAAGAAGG + Intronic
955644679 3:61124355-61124377 CCTCCGTTAATGGAGGATGATGG - Intronic
956097276 3:65730396-65730418 CCTCATTTAAAGCAGGAAGCAGG + Intronic
957253900 3:77812104-77812126 CTTCAGAGGATGCAGGAACAAGG - Intergenic
958455476 3:94325906-94325928 CCTCAGTCAAGGCAGGAAGAAGG + Intergenic
959048225 3:101498392-101498414 CCTGATATAATGCACTAAGAAGG + Intronic
960543274 3:118883918-118883940 CCACACAGAATGAAGGAAGATGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
961531780 3:127544481-127544503 CCCCAGCTAAGGCAGGAGGAGGG + Intergenic
962241577 3:133755078-133755100 CCTCTGACAAAGCAGGGAGAAGG + Intronic
962880505 3:139572242-139572264 CCAGAGATGATGCAGAAAGAAGG + Intronic
964118390 3:153159701-153159723 CCCCTCGTAATGCAGGAAGAGGG - Intergenic
964635437 3:158853200-158853222 CCTCATATACTGCAGGCAGCCGG - Intergenic
966932591 3:184685464-184685486 CCCCAGATAAAGCAGGCAGTGGG + Intergenic
968588801 4:1447403-1447425 CCTCAGATCAGGCAGCAGGAGGG + Intergenic
970152882 4:13108282-13108304 CATGGGATAATGCAGCAAGAAGG - Intergenic
971435392 4:26617159-26617181 CATGGGATAATGCAGCAAGAAGG - Intronic
971679299 4:29675905-29675927 CCTCAGATAATGCAAAAGAACGG + Intergenic
973742334 4:53930167-53930189 CCACAGATAATGCAGCTAGATGG + Intronic
973956876 4:56071208-56071230 CTTAAGATAACACAGGAAGAGGG + Intergenic
974770478 4:66405080-66405102 CATGAGAGAATGCAGCAAGAAGG + Intergenic
974836579 4:67258493-67258515 TCTCAAATAATGAAGGATGATGG - Intergenic
975425517 4:74222355-74222377 CATGAGATGATGCAGTAAGAAGG - Intronic
975956581 4:79847972-79847994 ACTGAGATAATGCATGGAGATGG + Intergenic
976143098 4:82013448-82013470 CATGTGATAATGCAGCAAGAAGG + Intronic
976153908 4:82122132-82122154 CCTCGGATGATGCAGCAAGAAGG - Intergenic
977503999 4:97878740-97878762 CCCCAGACAATGCAGGATAATGG - Intronic
977712494 4:100143886-100143908 CATGGGATAATGCAGCAAGAAGG + Intergenic
978442020 4:108743466-108743488 CCTCAGGAAAAGCAGGAAGGAGG + Intronic
980049405 4:128024160-128024182 CATGAAATAATGCAGCAAGAAGG - Intronic
980541237 4:134200034-134200056 GTTAAGGTAATGCAGGAAGAGGG - Exonic
982291505 4:153787695-153787717 GCTCAGATACTTGAGGAAGAGGG - Intronic
983745692 4:171196693-171196715 CCTGACATAATGCAATAAGAAGG - Intergenic
985007536 4:185549091-185549113 CATGTGATAATGCAGGAAGAAGG + Intergenic
985393119 4:189513026-189513048 ACACAGAGAATGCAGGAAGGAGG + Intergenic
985409795 4:189671280-189671302 CCCCAGAGAAGGAAGGAAGAGGG - Intergenic
985546845 5:514275-514297 CCTCAGGTCAGGGAGGAAGAGGG - Intronic
987079121 5:14410533-14410555 CCTCTGATAACGCAGGCAGATGG + Intronic
987370209 5:17186360-17186382 CCACAGATAGTGGAGGAGGAAGG - Intronic
988209673 5:28187515-28187537 CCTCAGATGATGCAGCAATAAGG - Intergenic
988697611 5:33638954-33638976 ATTCAGATACTGCAGCAAGATGG - Intronic
989108157 5:37882772-37882794 CCTCTGAAATTCCAGGAAGAAGG + Intergenic
989350398 5:40479410-40479432 CATGAGATGATGCAGCAAGAAGG + Intergenic
989985309 5:50690150-50690172 CCTGAGAGGCTGCAGGAAGAAGG - Intronic
990594227 5:57296920-57296942 CCACATATAACGCGGGAAGAGGG - Intergenic
990719824 5:58681893-58681915 GCTGAGATAATGCTGGAAGAAGG + Intronic
991041764 5:62183325-62183347 CCTCTGATGATGCTGGAAAATGG - Intergenic
991419407 5:66426111-66426133 CCTCAGAGAAGACAGGAAGGGGG + Intergenic
992885270 5:81152469-81152491 CTACAGATATTGAAGGAAGAAGG - Intronic
993159352 5:84268833-84268855 GTTCAGATAATGCAGTAATAGGG + Intronic
993340546 5:86719967-86719989 CCTGAGAAAATGTAGGAAGGAGG + Intergenic
993751247 5:91671087-91671109 ACTCCCATAATGAAGGAAGAGGG + Intergenic
994399197 5:99257527-99257549 GATCAGATACTGTAGGAAGATGG - Intergenic
995237939 5:109851535-109851557 CATGTGATAATGCAGCAAGAAGG + Intronic
1000065091 5:157687382-157687404 ACTCAGACAACCCAGGAAGAAGG - Intergenic
1000506119 5:162120312-162120334 CCTGAGAGAATGAGGGAAGATGG - Intronic
1000695450 5:164375588-164375610 CCTCAGCTAATGTGGAAAGAAGG - Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001467034 5:171976670-171976692 GCTGGGATAATGCAGCAAGAAGG + Intronic
1001699923 5:173699426-173699448 TCTCCGATCATGCAGGACGATGG + Intergenic
1001748628 5:174111088-174111110 CCCCAGATAAGACAGGATGAAGG + Intronic
1003193049 6:3890915-3890937 CCTCACATAGTGGAAGAAGAAGG - Intergenic
1003731178 6:8826370-8826392 CTTCAGTAAATGGAGGAAGATGG - Intergenic
1004449105 6:15728227-15728249 CCTCAAATAATGCAGGAGTTAGG - Intergenic
1004537929 6:16520727-16520749 TCTCAGATAAGACAGGAAAATGG + Intronic
1005456922 6:26029082-26029104 CATCAGTTAAGGCAGGAACAGGG + Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1006174066 6:32111233-32111255 CCTCAGAGAAGACAGCAAGAAGG + Intronic
1006797881 6:36742608-36742630 CCTCAGGTAATTCAGAAAGGTGG - Intronic
1010062846 6:71645334-71645356 CATGGGATAATGCAGCAAGAAGG - Intergenic
1012698072 6:102415477-102415499 CCTAAGATCAGGCAGAAAGAAGG - Intergenic
1012836198 6:104271351-104271373 CCACAGATGAGGTAGGAAGAAGG - Intergenic
1013709832 6:112883887-112883909 CCTGAGAGAATGAATGAAGAGGG - Intergenic
1013794467 6:113870615-113870637 CCTCAGACACTGGAGGAAAATGG - Intergenic
1015182801 6:130378947-130378969 CATGAGATAATGCAGCAATAAGG - Intronic
1017933255 6:158979050-158979072 ACTCAGAGAATGCAGTGAGAGGG + Intronic
1018468418 6:164073984-164074006 CTTGAGATAATGCAGCAAGAAGG - Intergenic
1019720205 7:2565027-2565049 CCTCAGATAGTGCTTGAAGGAGG + Intronic
1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG + Intergenic
1023983914 7:45084474-45084496 CCTCAGAACTTGAAGGAAGAAGG - Exonic
1025869923 7:65422098-65422120 ACTCAGACAAGGCAGGAAGTTGG + Intergenic
1026641437 7:72129624-72129646 TCTCAAATAATATAGGAAGAAGG + Intronic
1027683741 7:81254865-81254887 CATGAGATAATGCAGCAAGAAGG - Intergenic
1029100785 7:98128382-98128404 CCTTTGAGAATGCAGGGAGAAGG + Intronic
1029562705 7:101313793-101313815 CCTCAGATAATGAGGGAACCTGG - Intronic
1030433565 7:109485194-109485216 CCTCACATAATGGAGAGAGAGGG - Intergenic
1030490788 7:110231405-110231427 CTCCAGAGGATGCAGGAAGAAGG + Intergenic
1030567527 7:111177791-111177813 CATCAGATATGACAGGAAGATGG + Intronic
1030793225 7:113755579-113755601 CCTCATATAATGCAATCAGAGGG - Intergenic
1031632586 7:124062539-124062561 CATGAGATGATGCAGCAAGAAGG + Intergenic
1031651558 7:124297265-124297287 CATCAAATAATGCAGAAATAAGG - Intergenic
1032025718 7:128440567-128440589 CTTCAAATAATACAGGAGGAGGG + Intergenic
1032683266 7:134207489-134207511 CCTCAGAAACTGCACCAAGAGGG + Intronic
1033211200 7:139461570-139461592 CATCAGTTAAGGCAGGAACAGGG - Intronic
1034530110 7:151690329-151690351 CCTCAGATCATGCAAACAGAGGG - Intronic
1035559646 8:594829-594851 TCTCAGGTAAAGCAGGAACAGGG + Intergenic
1036191458 8:6674412-6674434 CCTCAGATCATTGATGAAGATGG - Intergenic
1036465622 8:8994318-8994340 ACTCAGAGAAAGCATGAAGAAGG + Intergenic
1038013949 8:23497564-23497586 CCACAAATAAGGCAGCAAGAAGG - Intergenic
1038141335 8:24848469-24848491 TCTCATAAAATGCAGAAAGAAGG + Intergenic
1038919091 8:32062578-32062600 CTTGAAAAAATGCAGGAAGAAGG - Intronic
1039034621 8:33346275-33346297 CCTCAGATAATAGAAGAGGATGG - Intergenic
1039194923 8:35020361-35020383 CATGAGATGATGCAGCAAGAAGG - Intergenic
1039251673 8:35672305-35672327 CCTCAGATAATGGAGGGAGGGGG + Intronic
1039276911 8:35942911-35942933 AATCAAATAATGCAGGAAGTTGG + Intergenic
1040586533 8:48748569-48748591 CCTGGGATGATGCAGCAAGAAGG + Intergenic
1042470147 8:69178214-69178236 CCACAGATAAGGCACGAAGAAGG - Intergenic
1043624981 8:82244967-82244989 CATGAGATGATGCAGCAAGAAGG + Intergenic
1047540952 8:125765853-125765875 CATGGGCTAATGCAGGAAGAAGG + Intergenic
1048237659 8:132707614-132707636 CATGAGATGATGCAGCAAGAAGG + Intronic
1048283045 8:133119524-133119546 CATGAGAGAATGCAGAAAGAAGG - Intronic
1048471012 8:134704134-134704156 GCTCAGGTAATGCAGGGAAAAGG - Intronic
1048748637 8:137645368-137645390 CCACAGATAATGACTGAAGAAGG + Intergenic
1049567150 8:143346772-143346794 CCTGGGGTAATGCAGCAAGAAGG - Intronic
1050291129 9:4156247-4156269 ATTAAGATAATGGAGGAAGAAGG - Intronic
1051596460 9:18829026-18829048 CCTCAGGAGATGCAGGAAGAGGG + Intronic
1052211751 9:25912464-25912486 CCTACTATAATTCAGGAAGAGGG - Intergenic
1052976177 9:34412017-34412039 GCTCAGATCATGCTGGAAGGTGG + Intronic
1053091783 9:35285210-35285232 CCTGTGCTAATGGAGGAAGAAGG - Intronic
1054861785 9:69961270-69961292 CATGAGATGATGCAGCAAGAAGG + Intergenic
1055277956 9:74641039-74641061 GCTCAGAGAATGGAGAAAGAAGG - Intronic
1055861021 9:80748848-80748870 CCTGAGATAAGGCCGAAAGATGG - Intergenic
1056853998 9:90109284-90109306 CATGGGATAATGCAGCAAGAAGG - Intergenic
1057000838 9:91507653-91507675 CTCCAGAAAATGGAGGAAGAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057597614 9:96428666-96428688 CCTCAGTTAGTGAAGGAACAAGG + Intergenic
1058124550 9:101176508-101176530 CCACAGATACTGCAAGAAGGTGG - Intronic
1058618033 9:106856011-106856033 TCACAGATAATACAGGAAGAAGG - Intergenic
1058918217 9:109587871-109587893 CCTCAGAGACTGCAGGAGGAAGG + Intergenic
1059784223 9:117563159-117563181 CCTAAGATAATGCATGTAAAAGG + Intergenic
1059947816 9:119429818-119429840 CTTCAGAAAATGCATGAATAAGG + Intergenic
1060442635 9:123655966-123655988 CCCCAGAGTAAGCAGGAAGATGG - Intronic
1060601675 9:124882286-124882308 GCTCAGAGAAGGCAGGAACAGGG + Intronic
1061483157 9:130907083-130907105 AATCAGATGATGCAGGAATAGGG + Intronic
1061812060 9:133167934-133167956 CCTTAGCTAGTGCAGGATGATGG - Intergenic
1203661770 Un_KI270753v1:51151-51173 CCCCAGAGAAGGAAGGAAGAGGG + Intergenic
1203672961 Un_KI270755v1:34200-34222 CCCCAGAGAAGGAAGGAAGAGGG + Intergenic
1186944689 X:14552723-14552745 CCTCAGGCAATGGAGGTAGAAGG - Intronic
1188623883 X:32260469-32260491 CCTAAGATCATGCAGAATGAGGG - Intronic
1188833255 X:34927434-34927456 CCACAGGTTGTGCAGGAAGATGG + Intergenic
1189495188 X:41502224-41502246 CCTGATATAATGCACTAAGAAGG + Intergenic
1192072172 X:67952638-67952660 CATGAGATGATGCAGCAAGAGGG - Intergenic
1195805902 X:108764781-108764803 CTCCAGAGAATGCAGCAAGAAGG - Intergenic
1196254262 X:113497400-113497422 CCTCAGCCAATGCAGTGAGAGGG - Intergenic
1196328282 X:114435055-114435077 CTTCAGTTAATTTAGGAAGAAGG + Intergenic
1196804992 X:119575309-119575331 TCTCAGATGAAGCAGGGAGAAGG + Intronic
1198970633 X:142275041-142275063 GCTCAGATAATTGATGAAGATGG - Intergenic
1199293449 X:146131004-146131026 CCTGTGATGATGCAGCAAGAAGG - Intergenic
1199477826 X:148265291-148265313 CATGTGATAATGCAGCAAGAAGG - Intergenic
1200836496 Y:7737407-7737429 ACACAGATAATGCAGGCAAATGG - Intergenic