ID: 1124101863

View in Genome Browser
Species Human (GRCh38)
Location 15:26703241-26703263
Sequence CAGGCACCGGCACCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124101855_1124101863 11 Left 1124101855 15:26703207-26703229 CCTCACAGTTCTAGAGGCTGGAA 0: 11
1: 123
2: 329
3: 609
4: 1039
Right 1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG 0: 1
1: 0
2: 1
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124101863 Original CRISPR CAGGCACCGGCACCTGGTGG GGG Intronic
900300122 1:1972992-1973014 CAGGCACCAGAAGCTGCTGGAGG - Exonic
900649606 1:3724352-3724374 CAGGGATGGGGACCTGGTGGGGG - Intronic
901172103 1:7266691-7266713 CAGGCACTGGCCCTTGGTGACGG + Intronic
901233218 1:7652644-7652666 CAGTCACCAGCCCCTGGTGAAGG + Intronic
901425341 1:9179108-9179130 CAGGCAGTGGCACCTGGGGAAGG - Intergenic
901852255 1:12022999-12023021 CAAGCAACAGCACCGGGTGGAGG - Intronic
902116840 1:14128235-14128257 CAGGCACCAGCACCCCTTGGTGG - Intergenic
902520198 1:17011592-17011614 CAGGAAGCGGGACCTGGTTGGGG - Intronic
903582999 1:24386403-24386425 CAGGCAGCGGCAGCTGGAGCTGG + Intronic
904054153 1:27659308-27659330 CAGGCACCGCCTCCTGGTGTCGG - Intergenic
904684188 1:32248690-32248712 GAGGCACCAGCTCCTGGCGGGGG + Exonic
906035661 1:42748900-42748922 TAGGCACCGTCACGTCGTGGTGG + Intronic
908260973 1:62339025-62339047 CAGTCTCCCCCACCTGGTGGTGG + Intergenic
909230386 1:73081796-73081818 CACACACCGGGACCTGTTGGGGG - Intergenic
910518381 1:88088708-88088730 CAGGCAGCTGCAGCTGGTGTTGG + Intergenic
910799732 1:91133107-91133129 CAGACACCGGGGCCTGTTGGGGG + Intergenic
914438107 1:147678664-147678686 GAGGCACTGGCATCTGGTGAAGG + Intergenic
915591763 1:156874896-156874918 CAGCCACCGAGACCTGGTGGGGG - Exonic
915665222 1:157438184-157438206 CAGGCACAGCCACTTGGTAGGGG + Intergenic
916468929 1:165103386-165103408 CACGCACCGGGGCCTGTTGGGGG - Intergenic
916966214 1:169945247-169945269 CAGGCACCGGCAACAGGGAGAGG + Intronic
917060617 1:171033268-171033290 CAGGCAGCGGCAGCTGGCGCTGG + Intronic
917329761 1:173868705-173868727 CAGGGACCGGCTCCAGGCGGCGG - Intronic
917926758 1:179795545-179795567 ATGGCACCAGCATCTGGTGGGGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
920535589 1:206734577-206734599 AAGGTGCCAGCACCTGGTGGTGG - Intergenic
921046152 1:211479308-211479330 CAGGTTCCGGCAGCTGCTGGCGG - Exonic
921129229 1:212205383-212205405 AAGGCACTGGCATCTGGTGAGGG - Intergenic
923917861 1:238529589-238529611 CAGGCACCGGCATCTGGATTTGG + Intergenic
1062823144 10:549626-549648 AAGCCCCCGGCACCTGGTCGGGG - Intronic
1063286563 10:4694848-4694870 CCGGCACCTGTATCTGGTGGGGG - Intergenic
1063368560 10:5506735-5506757 CAGGCACCCGCAGCTCCTGGTGG - Intergenic
1063450139 10:6145402-6145424 CCGGCTCGGGCACGTGGTGGCGG - Intronic
1064319723 10:14293328-14293350 ATGGCACCGGCATCTGGTGAGGG - Intronic
1064484859 10:15775755-15775777 CAGGCACCAGGAGCTGGAGGGGG - Intergenic
1064651810 10:17517099-17517121 CAAGCAAGGGCACCTGTTGGAGG - Intergenic
1064711630 10:18133008-18133030 CACACACCGGGACCTGTTGGGGG - Intergenic
1064909586 10:20385274-20385296 AAGGCACTGGCATCTGGTGAGGG - Intergenic
1066445662 10:35480410-35480432 GAGGCACGGGCTGCTGGTGGAGG + Intronic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067266240 10:44747976-44747998 CAGGCACCCCCACCTGGGTGCGG - Intergenic
1067375892 10:45727431-45727453 CCGGCACCAGCTCCTGGTCGGGG - Exonic
1067479094 10:46583957-46583979 CAGGGCCCAGCACCTGCTGGCGG + Intronic
1067615645 10:47757844-47757866 CAGGGCCCAGCACCTGCTGGCGG - Intergenic
1068226854 10:54117314-54117336 CAGGCACCTGCATCTGGATGAGG + Intronic
1068443816 10:57095117-57095139 CAGGCACCTGCAGCAGGGGGAGG - Intergenic
1068652130 10:59534183-59534205 CACACACCGGGACCTGTTGGGGG + Intergenic
1070174195 10:73956507-73956529 CAGGGGCCAGCTCCTGGTGGAGG - Intergenic
1071071262 10:81697063-81697085 CAGGCAGCTGCAGCTGGTGCTGG - Intergenic
1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG + Intronic
1073284546 10:102379843-102379865 GAGGAAACAGCACCTGGTGGGGG - Exonic
1073916610 10:108412121-108412143 AAGGCACTGGCATCTGGTGAAGG - Intergenic
1074548213 10:114418610-114418632 CTGGCACTGGCATCTGGTGAGGG - Intergenic
1075161709 10:120030100-120030122 CAGGTTCAGGCACCTGCTGGGGG + Intergenic
1075183345 10:120232306-120232328 AAAGCACCGGCATCTGGTGAGGG - Intergenic
1075629646 10:123993336-123993358 CACACACCGGGACCTGTTGGAGG + Intergenic
1076065943 10:127448015-127448037 CAGGCAGCCTCACCTGGTGCTGG + Intronic
1076636275 10:131884151-131884173 GAGGCACAGACACCTGCTGGGGG + Intergenic
1076683331 10:132186284-132186306 CAGGGACCGGGACGCGGTGGTGG - Intergenic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1077210802 11:1370181-1370203 CAGGCACTGGGGCTTGGTGGGGG + Intergenic
1077256580 11:1586799-1586821 CAGGCACCCACACCTGCAGGAGG - Intergenic
1077411676 11:2406648-2406670 CAGGCCCCCGCACCTGTGGGCGG + Exonic
1078091737 11:8268396-8268418 CGGGCACCGGCACCGGGCGCCGG + Intronic
1079701612 11:23555651-23555673 AAGCCACCTGAACCTGGTGGTGG + Intergenic
1086850327 11:91800211-91800233 CAGGCACCAGCATCTGGATGAGG - Intergenic
1087399067 11:97641157-97641179 CACACATCGGGACCTGGTGGGGG + Intergenic
1088084498 11:105960632-105960654 CAGGCAGCAGCAGCTGGTGCTGG + Intronic
1088356451 11:108949064-108949086 CACACACCGGGACCTGTTGGGGG - Intergenic
1089564435 11:119363592-119363614 GTGGCCCCGGCACCAGGTGGTGG - Intronic
1090071470 11:123548013-123548035 CAGGCTCCGGCATCTGGGGTGGG + Intronic
1090260643 11:125316270-125316292 CAGGCCCCGGCACTGGATGGAGG - Intronic
1090383524 11:126343402-126343424 CACTCACCTGCCCCTGGTGGAGG - Exonic
1092462687 12:8699775-8699797 CAGACTCCAGCACCTGGTAGGGG - Exonic
1092887149 12:12934844-12934866 CGGGCACAAGCACCTGCTGGGGG - Intergenic
1095735334 12:45549693-45549715 AAGGCACCAGCACCTGGTGAGGG - Intergenic
1096460970 12:51821341-51821363 CGGGCCCCGGCTCCTCGTGGGGG - Intergenic
1097029076 12:56079165-56079187 CAGGTCCGGGCAGCTGGTGGGGG + Intergenic
1097185505 12:57194344-57194366 CAGTCGGTGGCACCTGGTGGGGG - Exonic
1097277553 12:57823715-57823737 ACTGCACAGGCACCTGGTGGGGG + Exonic
1099295259 12:80821865-80821887 CAGGCACAGGCAGCTGGGAGAGG - Intronic
1101987194 12:109456611-109456633 TGGGCACAGGCACCAGGTGGAGG + Intronic
1102568216 12:113811122-113811144 CACACACCGGGACCTGTTGGGGG - Intergenic
1104450921 12:128867635-128867657 CAGGCACTGGCGCCTGCTGGGGG - Intronic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1105484461 13:20813188-20813210 CAGGGGCGGGGACCTGGTGGGGG - Intronic
1107523502 13:41206298-41206320 CTGGCACTGGCATCTGGTGAGGG - Intergenic
1108051172 13:46440625-46440647 CAGCCACCGGACACTGGTGGAGG + Intergenic
1109543727 13:63814245-63814267 CAGCCACCGGACACTGGTGGAGG + Intergenic
1110159329 13:72357033-72357055 AAGGCACCAGCATCTGGTGTGGG + Intergenic
1113374349 13:109750382-109750404 GAGGCAGAGGCAGCTGGTGGTGG + Intergenic
1113430442 13:110245801-110245823 CTGTCACCGGCACCGGCTGGGGG - Intronic
1114058573 14:18998981-18999003 CAGGCACCAGAACATGATGGGGG + Intronic
1114065007 14:19053265-19053287 CAGCCACCTGCACATGGCGGGGG - Intergenic
1114097254 14:19346737-19346759 CAGCCACCTGCACATGGCGGGGG + Intergenic
1114103974 14:19402773-19402795 CAGGCACCAGAACATGATGGGGG - Exonic
1115016088 14:28615974-28615996 CATGCACCGGGTCCTGTTGGGGG - Intergenic
1116364965 14:44048484-44048506 CACACACCGGCACCTATTGGGGG + Intergenic
1119035412 14:71226387-71226409 AAGGCACTGGCAGCTGGTGAGGG + Intergenic
1119455203 14:74749213-74749235 AAGGCACTGGCATCTGGTGAGGG + Intergenic
1121259512 14:92555928-92555950 CAGGATCCTGCACCGGGTGGTGG + Exonic
1121739682 14:96242742-96242764 CAGGTACCGGCTGGTGGTGGGGG - Exonic
1122478817 14:102032285-102032307 CAAGAAGCAGCACCTGGTGGAGG + Exonic
1122636713 14:103133376-103133398 CTTGCACCTGCACCTGGTGAAGG + Exonic
1122801408 14:104231559-104231581 CCTGCACCAGCACTTGGTGGTGG + Intergenic
1123017199 14:105381090-105381112 CAGCCCCCATCACCTGGTGGAGG - Exonic
1123179934 14:106460163-106460185 CAGACAGCGCCACCTGGGGGTGG - Intergenic
1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG + Intronic
1124970710 15:34487506-34487528 CACACACCGGCACCTGTTGTGGG + Intergenic
1125724754 15:41862579-41862601 CAGGCACAGGCAGCAGGAGGTGG - Exonic
1126128624 15:45319142-45319164 CAGACACCGGGGCCTGTTGGGGG + Intergenic
1126882702 15:53116408-53116430 AAGGCACTGGCATCTGGTGAGGG - Intergenic
1127797851 15:62453973-62453995 CAGCCACTGGCACCTGGGGGTGG - Intronic
1127798191 15:62455865-62455887 CAGGCACAGGGAACAGGTGGCGG - Intronic
1128155909 15:65391873-65391895 AAGGCGCCGGCACCAGGTGAGGG - Exonic
1129086708 15:73101558-73101580 CAGGCCTCAGCACATGGTGGGGG - Intronic
1129711527 15:77822689-77822711 CAGCCACCAGCCCCTGGTAGAGG - Intergenic
1132575423 16:661661-661683 CATGCACCGGCTCCGGGAGGCGG - Exonic
1132726827 16:1342520-1342542 CAGCCACAGGCACCTCCTGGGGG - Exonic
1132801736 16:1757977-1757999 GGGGCACCGGGACCTGCTGGAGG + Intronic
1132840053 16:1974528-1974550 CTGTCACCAGCACCTGGGGGAGG - Exonic
1133336069 16:5007477-5007499 CAGGCCCTGGCACCTCGTGGGGG - Exonic
1136861991 16:33710109-33710131 CAGGAATTGGCACCTGGTTGTGG + Intergenic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1141282327 16:82639900-82639922 TAGGCACGGCCACCAGGTGGCGG - Intronic
1141798023 16:86287469-86287491 GAGGCTGCGGCAGCTGGTGGGGG - Intergenic
1142157295 16:88538389-88538411 GAAGCACAGGCACCTGGGGGCGG - Intergenic
1143508690 17:7383699-7383721 CAGCCACTGGGACCTGGAGGTGG - Exonic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1144754961 17:17674085-17674107 ATGGCACCAGCATCTGGTGGGGG + Intergenic
1144916453 17:18727515-18727537 CTGACACCGACACCTGGCGGGGG - Exonic
1146906607 17:36622134-36622156 CAGCCTCTGGCCCCTGGTGGAGG - Intergenic
1146930744 17:36776176-36776198 CAGACACCGGGGCCTGCTGGAGG + Intergenic
1147558653 17:41495836-41495858 CTTGCACAGGCACCTGTTGGGGG - Intergenic
1147742098 17:42675544-42675566 CCGGCGCCAGCACCTGGCGGAGG - Intronic
1148149342 17:45387089-45387111 CACGGCCCAGCACCTGGTGGTGG - Intergenic
1148442946 17:47721189-47721211 TAGGCACGGGCACGGGGTGGGGG - Intergenic
1148889904 17:50799980-50800002 CAGCCACTGGGCCCTGGTGGAGG + Intergenic
1149169595 17:53793021-53793043 CAGGCACCAGCATCTGGATGAGG - Intergenic
1150565297 17:66333699-66333721 CAGGCACTGGTTCCTGGGGGAGG - Intronic
1151627227 17:75284527-75284549 CTGGCGGCGGCACCTGGTGGCGG + Intronic
1152106290 17:78331066-78331088 CAGGAGCCGGCACGTGGTAGTGG - Intergenic
1152518079 17:80837787-80837809 GAGGCCACGGCAGCTGGTGGGGG - Intronic
1152754501 17:82081619-82081641 CAGCCAGCGGGACCTGGTGGAGG - Exonic
1153536510 18:6107769-6107791 CAGCCACAGGCATCTGCTGGTGG - Intronic
1158313438 18:56184321-56184343 CAGGCACCGGGGCCTGCTTGAGG - Intergenic
1159263134 18:66042529-66042551 AAGGCACCAGCATCTGGTGATGG + Intergenic
1160243237 18:77137533-77137555 CAGGCACAGGCAGCAGGGGGTGG - Intergenic
1161356368 19:3821380-3821402 GAAGCAGCGGCACCTGGCGGAGG - Exonic
1161453204 19:4357941-4357963 CCGGGATCGGCACCTGGTGGTGG - Intronic
1161967628 19:7557033-7557055 CAAGGACGGGCACCTGCTGGTGG + Intronic
1162794307 19:13078698-13078720 CAAGCACAGGCAGCGGGTGGTGG - Exonic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1163330309 19:16632419-16632441 CAAGCCCCGGAACCTGGTTGGGG + Intronic
1163441488 19:17324433-17324455 CTGGCACCGGAGCATGGTGGGGG + Intronic
1164505183 19:28854366-28854388 ATGGCACCAGCACCTGGTGAGGG - Intergenic
1165466428 19:35977638-35977660 CAGGCAGCAGCACCAGATGGCGG - Intergenic
1165997244 19:39852961-39852983 AAGGCACCAGCATCTGGTGTTGG + Intergenic
925130049 2:1488355-1488377 CAGGCTCTGGGACCTTGTGGTGG - Intronic
925433233 2:3815032-3815054 CAGGCAGCTGCAGCTGGTGCTGG + Intronic
925730046 2:6913248-6913270 AAAGCACCGGCAGCTGGTGGAGG - Intergenic
926243319 2:11104547-11104569 TGGGCACCTGCACCTGGTGGCGG + Intergenic
926278162 2:11421667-11421689 CAGGGGCCGGCACCTGGTATGGG + Intergenic
926390982 2:12392663-12392685 CAGGCACCAGATCCAGGTGGTGG + Intergenic
926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG + Intergenic
927420024 2:22921018-22921040 CAGACACCGGGACCTAGTTGAGG + Intergenic
928186392 2:29115164-29115186 CCGGCCCCAGCAGCTGGTGGGGG + Intronic
928637982 2:33267064-33267086 CAGGCACCAGCATCTGGAGATGG - Intronic
929370877 2:41222773-41222795 CAGGCAGCTGCAACTGGTGCTGG - Intergenic
930335017 2:50034473-50034495 CTGACACCGGGACCTAGTGGAGG + Intronic
931491052 2:62747939-62747961 AAGGCATCGGCATCTGGTGAGGG - Intronic
932006998 2:67937217-67937239 ATGGCACCGGCATCTGGTGAGGG - Intergenic
934614398 2:95762375-95762397 CTGGCACCAGCACCTGGGGAGGG - Intergenic
934646505 2:96062124-96062146 CTGGCACCAGCACCTGGGGAGGG + Intergenic
934839906 2:97618206-97618228 CTGGCACCAGCACCTGGGGAGGG + Intergenic
935647589 2:105353034-105353056 ATGGCACTGGCACCTGGTGAGGG + Intergenic
937318605 2:120947662-120947684 CAGGGCCGGGCACCTGGTAGGGG - Intronic
937931460 2:127208506-127208528 CAGGCAGCCGCAGCTGGTGCTGG - Intronic
938136869 2:128766094-128766116 CAGGCAGCTGCAGCTGGTGCTGG + Intergenic
938891477 2:135710064-135710086 CCACCACCGCCACCTGGTGGGGG + Exonic
939802002 2:146721502-146721524 CGGGCACCAGCACCTGGATGAGG - Intergenic
940174727 2:150865417-150865439 AAGGCACCAGCATCTGGTGAGGG + Intergenic
941738287 2:169005029-169005051 ACAGCACCTGCACCTGGTGGAGG + Intronic
942334889 2:174872804-174872826 CAGGAATGGGCACCTGGTTGGGG + Intronic
942954634 2:181759695-181759717 CACACACTGGCACCTGTTGGGGG - Intergenic
945071174 2:205990491-205990513 AAGGCACCAGCATCTGGTGAGGG - Intergenic
945305296 2:208254354-208254376 CAGGCACCCGGAACTGGCGGGGG + Intronic
945865371 2:215168582-215168604 CAGGCACCGGGGCCTGTCGGAGG + Intergenic
945921228 2:215756521-215756543 CTGGCAGCTGCTCCTGGTGGGGG - Intergenic
946138743 2:217669761-217669783 ATGGCACCAGCATCTGGTGGTGG + Intronic
946396238 2:219445006-219445028 CGGGCCACGGCACCTGGGGGTGG + Exonic
946416398 2:219542137-219542159 CAGGCAGAGGCTGCTGGTGGCGG - Exonic
948839759 2:240643147-240643169 CTGGCAGCTGCAGCTGGTGGGGG - Intergenic
948895811 2:240926357-240926379 CAGGCACCAGCCCCTGTGGGAGG + Intronic
949044567 2:241866607-241866629 CCAGGACCGGCAGCTGGTGGGGG - Intergenic
1169177303 20:3528567-3528589 CAGACACCGGGACCTGCTTGAGG + Intronic
1169777153 20:9268017-9268039 CAGGCAGCTGCATCTGGTGAAGG - Intronic
1170737294 20:19022982-19023004 CATGCAGCTGCAGCTGGTGGGGG - Intergenic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171412802 20:24958054-24958076 CAGGCACCAGCACACGGTGGTGG - Intronic
1171424872 20:25043039-25043061 CAGGGCCCAGGACCTGGTGGAGG - Intronic
1171772667 20:29336435-29336457 CAGGCACCGGGGCCTGTTGTGGG + Intergenic
1171990681 20:31694139-31694161 CAGGAACTGGCACCTGTAGGGGG + Intronic
1174543595 20:51308442-51308464 GAGGCACCTGCTTCTGGTGGGGG - Intergenic
1174617005 20:51843440-51843462 CAGGCACCGCCACCAGGAGTTGG + Intergenic
1175221473 20:57419518-57419540 CACACACCGGGACCTGTTGGGGG - Intergenic
1175640738 20:60628214-60628236 CAGGCAAGTGCCCCTGGTGGAGG - Intergenic
1176000688 20:62830085-62830107 CAGCCACAGGGCCCTGGTGGGGG + Intronic
1176112154 20:63415672-63415694 AAGGCTCCGGCACCTCGTGGTGG - Intronic
1176177814 20:63737006-63737028 CAGGCAGCAGCAGCTGCTGGGGG - Intronic
1176180590 20:63747613-63747635 CAGGCAGAGACTCCTGGTGGGGG + Intronic
1176296521 21:5076214-5076236 CAGGCAGTGGCCCCTGGTGCCGG - Intergenic
1176671960 21:9743770-9743792 CAGCCCCCGGCACCTGGAGAGGG - Intergenic
1178955061 21:37014592-37014614 AGGGCAAAGGCACCTGGTGGAGG - Intronic
1179860528 21:44185907-44185929 CAGGCAGTGGCCCCTGGTGCCGG + Intergenic
1180214066 21:46313773-46313795 CTGGCAGCAGCACATGGTGGAGG - Intronic
1180477058 22:15721600-15721622 CAGGCACCAGAACATGATGGGGG + Intronic
1180483496 22:15775885-15775907 CAGCCACCTGCACATGGCGGGGG - Intergenic
1181311739 22:21948645-21948667 CAGGCACTGGCAGTTGCTGGGGG - Intronic
1181412094 22:22731224-22731246 CAGGCACAGGCACATGGTGAGGG - Intergenic
1181673082 22:24434997-24435019 CAGGGACAGCCACCTGGTGCAGG - Intronic
1181934852 22:26430711-26430733 CAGGCCCCTGCACCCGGAGGTGG - Intronic
1183136014 22:35888582-35888604 CTGGCACCTGCATCTGGTGAGGG + Intronic
1184125536 22:42484058-42484080 GCGGCACCCGCTCCTGGTGGTGG + Intergenic
1184134020 22:42535556-42535578 GCGGCACCCGCTCCTGGTGGTGG + Intergenic
1184347885 22:43924352-43924374 CATGCACGGGCGCCTGATGGGGG - Intronic
1184434614 22:44462856-44462878 CTGGCACCGGCAGCTGGTGCTGG + Intergenic
1185169211 22:49282711-49282733 CAGGCACAGGGACCTGGGTGGGG - Intergenic
949289525 3:2448173-2448195 CAGGCAGCGAAGCCTGGTGGGGG + Intronic
950425366 3:12922301-12922323 CAGGCACCACCACCTGGGGGTGG - Intronic
950456266 3:13094561-13094583 CAGGGTCTGGCACCAGGTGGGGG - Intergenic
952686237 3:36151785-36151807 AAGGCACCAGCAACTGGTGAGGG + Intergenic
954428060 3:50453998-50454020 CAGGCACCGGAACCCGGGTGTGG - Intronic
954886759 3:53881859-53881881 CAGGCCCCAGCCCCTGGTGGGGG - Intronic
955944805 3:64182619-64182641 AAGGCACCAGCATCTGGTGAGGG - Intronic
955968116 3:64409766-64409788 AAGGCACTGGCATCTGGTGAGGG + Intronic
964294244 3:155216041-155216063 CACACACCGGGACCTGTTGGGGG - Intergenic
966237429 3:177717723-177717745 CAGGCACAGAAATCTGGTGGTGG + Intergenic
966250550 3:177860435-177860457 CAGGCAGCTGCAGCTGGTGCTGG + Intergenic
966756209 3:183373967-183373989 CAGGCACTGGGGACTGGTGGAGG - Intronic
968004066 3:195227274-195227296 CAGGCATCGCCACCTCCTGGTGG + Intronic
968279695 3:197466972-197466994 CAGGCCCCCGCACTTGCTGGTGG + Intergenic
968478682 4:824706-824728 CAGGCAGCCGCTCCAGGTGGGGG - Intronic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
972270080 4:37502502-37502524 CAGGCACAGGGTGCTGGTGGGGG + Intronic
972312065 4:37891110-37891132 CAGGCACCGGCGGACGGTGGCGG - Exonic
973322348 4:48823371-48823393 CACACACCGGGACCTGTTGGTGG + Intronic
974548214 4:63339546-63339568 CACGCACCGGGACCTGTTGTGGG + Intergenic
979418229 4:120469928-120469950 AAGGCACTGGCATCTGGTGGGGG - Intergenic
981285229 4:143009827-143009849 CTGGCACCTGCTCCTGGTGAGGG + Intergenic
981953663 4:150443678-150443700 CACACACCGGCACCTGTTGTGGG + Intronic
985782824 5:1879989-1880011 CAGGCAGCGGCACCTGGTTGGGG - Intronic
985931776 5:3064085-3064107 CAGGCTCAGCCTCCTGGTGGAGG - Intergenic
986330063 5:6711460-6711482 CACACACCGGGACCTGTTGGGGG - Intergenic
986367132 5:7043620-7043642 CAGCCACCGGAAGCTGATGGAGG - Intergenic
987092200 5:14518078-14518100 CTGGCAACGGCAAATGGTGGCGG + Intronic
987190817 5:15476345-15476367 CACACACCGGGACCTGTTGGGGG + Intergenic
987594641 5:19981476-19981498 GAGGCACTGGCATCTGGTGAGGG + Intronic
987642615 5:20631838-20631860 CAGACACCGGGGCCTGTTGGGGG - Intergenic
987928751 5:24375658-24375680 CACACACCGGGACCTGTTGGGGG + Intergenic
989260738 5:39417134-39417156 CACACACCGGCGCCTGGTTGGGG + Intronic
992288463 5:75260295-75260317 CACACACCGGCACCTGTTGGGGG + Intergenic
996433176 5:123402966-123402988 AAGGCACTGGCATCTGGTGAGGG - Intronic
997336793 5:133114295-133114317 CAGGAATGGGCAGCTGGTGGAGG + Intergenic
997366212 5:133326874-133326896 CAGGCTGCAGCACCTGGTGAAGG - Intronic
997693707 5:135845162-135845184 CAGGCACTGGAAGCTGGTAGAGG - Intronic
999141282 5:149364040-149364062 GAGGCACCGGCGCGAGGTGGTGG + Exonic
999174721 5:149624017-149624039 CAGGCTCTGGGACGTGGTGGTGG - Exonic
999419843 5:151431381-151431403 CAGGGACTGGCAGCTGGTGGAGG + Intergenic
1000812318 5:165878221-165878243 CACACACCGGGACCTGTTGGGGG - Intergenic
1001462025 5:171924625-171924647 CTGGCACCGGCAGAGGGTGGAGG - Intronic
1003172077 6:3727753-3727775 GAGGCACGGGCAACAGGTGGAGG - Intronic
1003925543 6:10874380-10874402 AGGGCAGGGGCACCTGGTGGTGG + Exonic
1007412974 6:41675396-41675418 CAGGCCCTGGCTCTTGGTGGGGG + Intergenic
1008294765 6:49761991-49762013 TAGGCATCTGCACCTGGTGAGGG + Intergenic
1008637987 6:53431589-53431611 AAGGCACCAGCATCTGGTGAGGG - Intergenic
1010125003 6:72421402-72421424 CAGGCAGCTGCATCTGGTGAGGG + Intergenic
1011164262 6:84428496-84428518 CAGCCATCGCCACCTGTTGGTGG - Intergenic
1011769839 6:90663283-90663305 CATGCACCAGCACCTGGTGAGGG - Intergenic
1012198713 6:96377975-96377997 CAGACACCGGGACCTGCTAGAGG - Intergenic
1012787346 6:103647682-103647704 CACACACCGGGACCTGTTGGGGG + Intergenic
1014580035 6:123125998-123126020 CATGCACTGGGACCTGTTGGAGG - Intergenic
1015138579 6:129902973-129902995 CAGACAGAGGCACCTGGGGGAGG - Intergenic
1017051208 6:150395490-150395512 GAGGCACCGCCACCTGATTGAGG + Exonic
1018320264 6:162601088-162601110 AAGGCAACGGCACCTGGTGAGGG + Intronic
1018719291 6:166560689-166560711 CAGGCACCAGCAGGTGGAGGGGG + Intronic
1019712756 7:2524962-2524984 CAGGCAGCGGCAACAGGTGGCGG + Intronic
1020633835 7:10672392-10672414 CAGGCAGCGGCAGCTGGTGCTGG + Intergenic
1021378442 7:19937362-19937384 CACACACCGGGACCTGTTGGGGG - Intergenic
1022090947 7:27108004-27108026 CAGGCCCCGGCCCGTGGTGGTGG + Exonic
1022498283 7:30866706-30866728 CAGGCAAAGGCCACTGGTGGGGG + Intronic
1023014659 7:35955287-35955309 CAGGCACCAGCACCAAGAGGAGG + Intergenic
1023529175 7:41135842-41135864 CAGGCACCCGCGTCTGGAGGAGG + Intergenic
1023831310 7:44040331-44040353 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1027202421 7:76072309-76072331 CAGCCACCGGGCCGTGGTGGTGG + Intergenic
1029687248 7:102157273-102157295 CAGCCACAGGGACCTGGTTGGGG - Intronic
1029741640 7:102494637-102494659 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029759631 7:102593806-102593828 CAGGCACAGGAAGCTGGTGACGG + Exonic
1029776999 7:102689716-102689738 CAGGCACAGGAAGCTGGTGACGG + Intergenic
1031895970 7:127347977-127347999 CAGGCAGCGGCTCCCGGGGGCGG + Intronic
1032168971 7:129568320-129568342 ATGGCACTGGCATCTGGTGGGGG + Intergenic
1034215783 7:149404703-149404725 CAGGCACCAGCAACTGGACGAGG + Intergenic
1034706234 7:153147670-153147692 CAGGCACTGGCATTTGGTGAGGG - Intergenic
1034969844 7:155412133-155412155 CAGGCCCCAGCACTTGTTGGTGG - Intergenic
1035218973 7:157393606-157393628 CAGGCAGCTGAACCTGGTGTTGG - Intronic
1035268152 7:157703641-157703663 CAGGCAGAGGCACCTGCAGGAGG + Intronic
1036644018 8:10601097-10601119 CAGGCCCAGGCATCTGGTGCTGG + Intergenic
1037088335 8:14880784-14880806 CAGACACCGGGACCTGTTGTGGG + Intronic
1037755492 8:21707421-21707443 CAGGCACCAGCACCTTCCGGTGG - Intronic
1039566066 8:38553520-38553542 CAGGCCCCTGCACCTGGGGTTGG + Intergenic
1040111313 8:43568285-43568307 AAGGCACTGACCCCTGGTGGGGG + Intergenic
1040481796 8:47833499-47833521 CAGGCACCAGGACCTGGTCTTGG - Intronic
1041526105 8:58808086-58808108 CGGTCATCGCCACCTGGTGGTGG - Intronic
1041815165 8:61962260-61962282 CAGGCACTGGCATCTGGTGAGGG + Intergenic
1044561038 8:93612569-93612591 AAGGGGCCGGCATCTGGTGGGGG + Intergenic
1044598514 8:93981151-93981173 CAGGCACAGGCAATTGGAGGGGG - Intergenic
1044703019 8:94981306-94981328 CAGGCAGCTGCATCTGGTGAGGG - Intronic
1049012627 8:139897520-139897542 CAGTCACCGCCACATGGTAGAGG + Intronic
1049442871 8:142617222-142617244 CAGGGACGGGCACGGGGTGGGGG - Intergenic
1049610835 8:143554007-143554029 CAGACACCGGCAGGAGGTGGCGG - Intronic
1049682121 8:143923997-143924019 GAGGCAGCGGCAGCTGGCGGCGG - Exonic
1050605405 9:7295998-7296020 AAGGCACCAGCATCTGGTGTGGG - Intergenic
1052419409 9:28223248-28223270 CAGGCAACTGAACCTGCTGGAGG - Intronic
1052932704 9:34068619-34068641 AAGGCCCCAGCACCTGTTGGAGG - Intergenic
1055742350 9:79403697-79403719 TTTGCACTGGCACCTGGTGGAGG - Intergenic
1056841534 9:90001884-90001906 CAGAAAGGGGCACCTGGTGGAGG + Intergenic
1057146855 9:92764456-92764478 CAGGCCCCGGCGCCGGGCGGGGG + Intronic
1057443276 9:95097014-95097036 GGTGCACCGGCACCTAGTGGTGG + Intergenic
1057872698 9:98730370-98730392 CACGCACCAGTACCAGGTGGAGG - Intergenic
1059373022 9:113858613-113858635 CAGGCACCTGCACTTGGTAATGG - Intergenic
1060435191 9:123586797-123586819 GAGGCACCGGCACCTGGCGACGG - Intronic
1061012040 9:127961493-127961515 CAGTGCCTGGCACCTGGTGGGGG - Intronic
1061620958 9:131810975-131810997 CAGGCACCTGCTCCTGTTAGGGG + Intergenic
1061853658 9:133429776-133429798 CAAGAGCCGGCTCCTGGTGGGGG + Intronic
1062182518 9:135198254-135198276 CAGGCACCCGAACCTGGGTGTGG + Intergenic
1062279590 9:135746012-135746034 CACGCAGCGGCACCTGGGGAGGG - Intronic
1190053788 X:47170529-47170551 CAGGCAGCAGGAGCTGGTGGAGG - Intronic
1191253059 X:58268423-58268445 GAGGCACTGGCATCTGGGGGAGG + Intergenic
1191258468 X:58290097-58290119 AAGGCACTGGCCTCTGGTGGAGG - Intergenic
1191258566 X:58290547-58290569 AAGGCACTGGCTTCTGGTGGAGG - Intergenic
1191942423 X:66495521-66495543 CACACACCAGCACCTGTTGGGGG + Intergenic
1192577530 X:72255028-72255050 CAGGCACCGGCTCAGGGCGGGGG + Intronic
1195356982 X:104048353-104048375 CAGGCAATGGCAGGTGGTGGGGG + Intergenic
1195741246 X:108066804-108066826 CAGGGACCTGTTCCTGGTGGGGG + Intronic
1197403965 X:126027722-126027744 CAGGCAGTGGCAGCTGGTGTTGG + Intergenic
1198209866 X:134506795-134506817 CAGTCACTGGCAACTGGGGGTGG + Intronic
1200818181 Y:7555151-7555173 CAGGCAGCTGCAGCTGGTGCTGG - Intergenic
1201182690 Y:11364770-11364792 CAGGCACTGGGTCCTGTTGGGGG + Intergenic