ID: 1124103093

View in Genome Browser
Species Human (GRCh38)
Location 15:26713473-26713495
Sequence CTGAACCCAGCATTGTGTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124103093_1124103097 -2 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103097 15:26713494-26713516 AGGAGTAAGGAGAGAGGAAGAGG 0: 1
1: 2
2: 26
3: 261
4: 2152
1124103093_1124103096 -8 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103096 15:26713488-26713510 GGGTTCAGGAGTAAGGAGAGAGG 0: 1
1: 0
2: 2
3: 57
4: 452
1124103093_1124103098 5 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103098 15:26713501-26713523 AGGAGAGAGGAAGAGGCTACCGG 0: 1
1: 0
2: 6
3: 84
4: 683
1124103093_1124103101 23 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103101 15:26713519-26713541 ACCGGGATGATCCAGCCTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 145
1124103093_1124103100 20 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103100 15:26713516-26713538 GCTACCGGGATGATCCAGCCTGG 0: 1
1: 0
2: 0
3: 0
4: 49
1124103093_1124103099 6 Left 1124103093 15:26713473-26713495 CCGAAACACAATGCTGGGTTCAG 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1124103099 15:26713502-26713524 GGAGAGAGGAAGAGGCTACCGGG 0: 1
1: 0
2: 4
3: 52
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124103093 Original CRISPR CTGAACCCAGCATTGTGTTT CGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901237916 1:7677425-7677447 CTAGAAGCAGCATTGTGTTTGGG + Intronic
902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG + Intronic
903099888 1:21020142-21020164 CTGAGTTCAGCATAGTGTTTTGG - Intronic
907664941 1:56426462-56426484 TTGAAAACAGCATTGTGTCTAGG - Intergenic
909173379 1:72322585-72322607 CTGGATCCTGCATTGTGTCTTGG - Intergenic
909568347 1:77080475-77080497 CTGAACCAATTATTGTGTCTGGG - Intergenic
910303115 1:85730099-85730121 CTGAATACAGCTTAGTGTTTTGG + Exonic
910583408 1:88853135-88853157 CTCAACCCAGCATTTTGTATAGG + Exonic
910929237 1:92426240-92426262 CTGAAAACAGCTTTGTCTTTTGG - Intergenic
911803012 1:102167922-102167944 CTTATCCCACCATTGTATTTTGG + Intergenic
912784063 1:112581662-112581684 GTAATCCCAGCATTTTGTTTTGG - Intronic
915426141 1:155828514-155828536 CTGTGCCCAGCATTCTTTTTTGG - Intronic
918894576 1:190324349-190324371 CTGAACCCAGCTTTATGTATTGG - Intronic
921793035 1:219311593-219311615 CACAACCTAGCATGGTGTTTTGG + Intergenic
921851467 1:219936530-219936552 TTGAACCAAGCATTGTGATCAGG - Intronic
922890977 1:229061865-229061887 CTCTACCCAGCCTTGTGTTCAGG - Intergenic
923320638 1:232829620-232829642 CTGTTCCTAGCACTGTGTTTAGG + Intergenic
923357656 1:233176479-233176501 CTGAACTAAGCATGGTGCTTAGG + Intronic
923921498 1:238569461-238569483 CTGGGCCATGCATTGTGTTTCGG - Intergenic
1069730558 10:70609094-70609116 CTGGGCCCACCATTGTATTTTGG + Intergenic
1069906808 10:71736725-71736747 CTGAACCCAGCCTAGTGCCTGGG - Intronic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1072770350 10:98132722-98132744 CAGAATCCAGTATTGTGGTTGGG - Intergenic
1073187913 10:101627957-101627979 CAGAGCACAGCATTTTGTTTGGG - Intronic
1075941987 10:126397776-126397798 CTGAAACCAGAAATGTGTGTTGG + Intergenic
1076248553 10:128966617-128966639 AAGAACCCAGCTTTGTGTTTTGG - Intergenic
1076481499 10:130788085-130788107 CTGACCCCAGTGCTGTGTTTAGG - Intergenic
1078940152 11:15994053-15994075 ATGTACCCAGCATTGTGATGGGG + Intronic
1080131567 11:28801666-28801688 CTTATCCCACCATTGTATTTTGG - Intergenic
1081054292 11:38388675-38388697 CTGTACCCAAAATTTTGTTTGGG + Intergenic
1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG + Intergenic
1085994441 11:81893697-81893719 CTGTACCCAGCAGTGTGTCCAGG - Intergenic
1089630484 11:119781225-119781247 CTGACCCAGGCATGGTGTTTGGG + Intergenic
1090632207 11:128659580-128659602 CTGAACCAATCACTGTGGTTGGG + Intergenic
1090965304 11:131592834-131592856 CTGAGCCCAGCATTGTGGGGAGG - Intronic
1095991198 12:48035765-48035787 CTGAGCCCATCACTGTGGTTTGG - Intergenic
1097588450 12:61543422-61543444 CTGTACCCAGCATGGTGTTCTGG + Intergenic
1097805962 12:63965255-63965277 ATGAACACATCATTGGGTTTTGG + Intronic
1098031027 12:66254160-66254182 CTTTACCCAGCAGTTTGTTTAGG + Exonic
1098093355 12:66927797-66927819 CTGGACTTAGCATTGGGTTTGGG - Intergenic
1101245991 12:102885022-102885044 CTAAGCCCAGCATTGCTTTTTGG - Intronic
1102416788 12:112770034-112770056 CTTCACCCAACATTGTGTCTTGG + Intronic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1104590132 12:130077726-130077748 CTGAACACTGCATGATGTTTTGG - Intergenic
1106127487 13:26912303-26912325 CTGAGCCCTGCATTGTTTTATGG + Intergenic
1106451188 13:29884083-29884105 CTGACCTCAGCATTCTCTTTTGG - Intergenic
1106691114 13:32117776-32117798 CTGAAGTCAGCATTCTGCTTTGG - Intronic
1107254293 13:38405147-38405169 CTGAAGCCATCATTTTGTTCTGG + Intergenic
1107877307 13:44802161-44802183 CAGAACCCAGCATTGCATTCTGG - Intergenic
1109164902 13:59021513-59021535 CTGAAGCGAGGATTGTGTTGAGG + Intergenic
1110074884 13:71227798-71227820 CTGAATCCAGCATTGACCTTAGG - Intergenic
1110267549 13:73555641-73555663 CTGTACCTAGCATTGTGTTCAGG - Intergenic
1110645434 13:77877846-77877868 CTGTGCCCAGCATTGTGATGGGG + Intergenic
1111180507 13:84657407-84657429 CTGACCATAGCAGTGTGTTTGGG - Intergenic
1111206178 13:85013805-85013827 CTGTCCCCACCATTGTATTTTGG + Intergenic
1112605328 13:100898995-100899017 CTGAACCGAACAGTGTGATTTGG + Intergenic
1112629050 13:101140343-101140365 CTGAACACAGTATTTTGATTTGG - Intronic
1114026893 14:18535948-18535970 CAGAATCCACCAGTGTGTTTTGG - Intergenic
1114042744 14:18693787-18693809 CTGAACCCGGTATTGTGCTGAGG - Intergenic
1114089463 14:19272108-19272130 CTGACCCCAGCAGTGTGGCTTGG + Intergenic
1116214602 14:41996452-41996474 TTGAACCCAGGATGATGTTTTGG + Intergenic
1116600372 14:46914555-46914577 TTGAACCCAGCATTCCCTTTTGG - Intronic
1116683538 14:48009045-48009067 CTGAAACCAGCACAGTGTCTTGG + Intergenic
1117961834 14:61170999-61171021 CTACACCCAGCATTGGGTTTTGG - Intergenic
1120015602 14:79469934-79469956 ATGAAACCAGCTTTTTGTTTTGG + Intronic
1121045315 14:90783513-90783535 CTTAACCCAGGATTGTTTTGAGG - Intronic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1125840721 15:42798959-42798981 CAGCACCCAAAATTGTGTTTTGG - Intronic
1126503096 15:49369245-49369267 CTGCACCCGGCCTGGTGTTTTGG + Intronic
1130288316 15:82573478-82573500 TTGAAGGAAGCATTGTGTTTTGG - Intronic
1135631409 16:24038571-24038593 CTGTGCCCAGCATGGTGTATGGG - Intronic
1138984573 16:62312534-62312556 CTGAACCAATCACTGTGGTTAGG - Intergenic
1139226436 16:65236746-65236768 CAGATCCCAACATTGGGTTTGGG - Intergenic
1141860703 16:86714276-86714298 CAGGACCCAGCTTTGTGTCTGGG + Intergenic
1144171463 17:12663591-12663613 CTGAAGCCAGCATTGATTGTAGG - Intergenic
1147054857 17:37826265-37826287 CAGGACCCAGCATAGTGTCTGGG - Intergenic
1147378662 17:40038800-40038822 CTGAACAGAGCAGTGTATTTTGG - Intronic
1149990359 17:61379769-61379791 CTGCACCCTTCATTGAGTTTTGG + Intronic
1151972779 17:77467426-77467448 CTGAGCCCAGCACTGGGGTTGGG + Intronic
1153776573 18:8459334-8459356 CTGAGCACAGCATTGTTTTGAGG - Intergenic
1155444159 18:25893283-25893305 ATGAACACAGTATTGTGGTTGGG - Intergenic
1155653429 18:28168715-28168737 CTTAACCAAGCATTATGTTTTGG + Intronic
1157295345 18:46438151-46438173 GTTAACCCAGAACTGTGTTTTGG - Intronic
1157381212 18:47219633-47219655 CATAGCCCAGCACTGTGTTTGGG + Intronic
1158053320 18:53250371-53250393 CTGCACCCTGAATTGTGCTTGGG + Intronic
1158340652 18:56462422-56462444 CTGAATCCAGCCTTGTAATTAGG + Intergenic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1158935178 18:62358029-62358051 CTGACCCCAGCAGTGAGTTATGG - Intronic
1164185268 19:22861557-22861579 CTGGACCCAGCAGAGTGTATGGG - Intergenic
1164196557 19:22970636-22970658 CTGAACCCAGCACAGTGCATGGG + Intergenic
1164264640 19:23602941-23602963 CTGAACCCAGCACAGTGCATGGG - Intronic
1164514469 19:28922079-28922101 CCCATCCCAGCATTGTGTCTTGG + Intergenic
1164857189 19:31534207-31534229 CTGATTCCAGCATTCGGTTTGGG + Intergenic
1165210990 19:34235585-34235607 CTCTACTCAGCATTGTGTTTGGG + Intergenic
1165227835 19:34366700-34366722 CAGCACCAAGCCTTGTGTTTGGG + Intronic
1166764496 19:45244833-45244855 CTGATGACAGGATTGTGTTTGGG - Intronic
926070850 2:9889091-9889113 CTGCACCCAGCCTTCTGCTTGGG + Intronic
926321924 2:11754442-11754464 CTGAACCCAGGAGGGTGTTTCGG + Intronic
927541619 2:23916983-23917005 AAGAATCTAGCATTGTGTTTGGG - Intronic
928263309 2:29787285-29787307 CAGCACCCAGCACTGTGTCTCGG - Intronic
930555809 2:52894537-52894559 AGGCCCCCAGCATTGTGTTTAGG + Intergenic
932010871 2:67976264-67976286 CTGAAACCATCTTTGTGGTTAGG - Intergenic
932199069 2:69809877-69809899 CTGAACCCAGCTTTGAGGTGGGG - Intronic
936698442 2:114980691-114980713 TTGAACCTGGGATTGTGTTTTGG - Intronic
937115141 2:119399476-119399498 CTGGACCCAGCAGTGGGTGTGGG - Intergenic
937298172 2:120822283-120822305 CTGGACCCAGCAGTGTGCTATGG + Intronic
937941854 2:127292379-127292401 CTGGATCCAGCATTGTGTTCTGG - Intronic
937941861 2:127292434-127292456 CTGGATCCAGCATTGTGTTCTGG - Intronic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938267408 2:129938447-129938469 CTGAACCCGGTATTGTGCTGGGG + Intergenic
940479903 2:154214899-154214921 GTGAATCCAGCATTGTGCTAGGG - Intronic
940787766 2:158000701-158000723 CTGAGCCAAGCATTGTGCATGGG + Intronic
942663617 2:178292133-178292155 CTGTACCAATCATTGAGTTTCGG - Intronic
943286267 2:186005116-186005138 ATGATCCCAGCATGGAGTTTTGG - Intergenic
946069265 2:217017362-217017384 CTGAGCCCAGCATCCTTTTTTGG - Intergenic
946164057 2:217853156-217853178 TTGAAACCAACATTGTGTTCCGG - Intronic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1171355960 20:24545544-24545566 CTGAACCCCGCATTGAGCTCAGG - Intronic
1172196689 20:33096761-33096783 CTGGACCCAGCAATGTGTCCTGG + Intronic
1174321087 20:49742149-49742171 CTGATCCCAGGAGTGTGTGTAGG - Intergenic
1174685260 20:52448516-52448538 CTGAACCTTGCATACTGTTTGGG + Intergenic
1176290235 21:5040038-5040060 CTGCTCCCAGCATTCTATTTAGG + Intronic
1178154128 21:29831966-29831988 CTGTACCCACCATTGTATCTTGG - Intronic
1179867020 21:44223603-44223625 CTGCTCCCAGCATTCTATTTAGG - Intronic
1180451029 22:15463143-15463165 CAGAATCCACCAGTGTGTTTTGG - Intergenic
1180491242 22:15850239-15850261 CTGACCCCAGCAGTGTGGCTTGG - Intergenic
1183748323 22:39704869-39704891 CAGAGCCCAGCTTTCTGTTTAGG + Intergenic
1184834867 22:47015097-47015119 CTGGACGCAGCAGGGTGTTTTGG + Intronic
950694431 3:14687522-14687544 CTGCACCTTGCATTCTGTTTTGG + Intronic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
951531172 3:23699453-23699475 GTGAGCCCAGCATTGTGCTAGGG + Intergenic
951612110 3:24501758-24501780 CTGAATTCAGCCATGTGTTTGGG - Intergenic
953677842 3:45017090-45017112 ATAAACCCAGCTGTGTGTTTAGG - Intronic
953971534 3:47352262-47352284 AGGAACCCAGCAGTGGGTTTTGG + Intergenic
954506654 3:51082375-51082397 CTGGACCCAGCATTGTTCCTGGG + Intronic
955351965 3:58200256-58200278 CTGAACCAATCATTGTGATCAGG - Intronic
958119386 3:89264226-89264248 CTTATCCCAGCATTGTGTTTAGG - Intronic
958553222 3:95643013-95643035 CTGTACCCACCATTGTATCTAGG - Intergenic
960776541 3:121262734-121262756 CTGATCCCACCATTGTATTTTGG - Intronic
961053711 3:123768499-123768521 CTGAGCCCTGCATGGTGTTAGGG - Intronic
961318670 3:126057522-126057544 CTGAACCCAGCACTGTGGTCGGG + Intronic
963359164 3:144248594-144248616 CTGAACCAATAAATGTGTTTAGG - Intergenic
963930538 3:151000031-151000053 CTGATCCCAACAATGAGTTTAGG + Intergenic
964978715 3:162651035-162651057 TTGAACCCAGAATTGGGTTCTGG + Intergenic
965028649 3:163335181-163335203 CTGTACCCCGCATTGTATCTAGG - Intergenic
965334192 3:167416001-167416023 CTGAACCAATCTCTGTGTTTAGG + Intergenic
966775551 3:183540106-183540128 CTGAACCAATCATTGTGGCTTGG - Intronic
967810167 3:193752952-193752974 GTGATCCCAGCACTTTGTTTGGG - Intergenic
972343386 4:38172261-38172283 CTGAAGCCAGTCTTGTGGTTTGG + Intergenic
972361097 4:38326139-38326161 CTGAACATAGCATTGAGTTAAGG + Intergenic
974630526 4:64481642-64481664 CTGAGCACAGCAGTGTGTTTAGG - Intergenic
979348729 4:119621326-119621348 CTGAACCAATCATTGTATTCGGG - Intronic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
982135158 4:152268328-152268350 CTGAAGCCACCGTTATGTTTTGG - Intergenic
986002669 5:3642532-3642554 CTGAAAACAGGATTGAGTTTAGG - Intergenic
986264685 5:6181597-6181619 CTGCACCCAGCATTGTCTTTGGG + Intergenic
986868348 5:12016275-12016297 CTGAACCCAGCCCTGTGTGGAGG + Intergenic
989195706 5:38714262-38714284 CTGACCCCAACATTTTGTGTTGG - Intergenic
989731923 5:44659293-44659315 CTGAATTAAACATTGTGTTTAGG + Intergenic
991689661 5:69213882-69213904 CCTGACCCATCATTGTGTTTTGG + Intergenic
992415621 5:76550152-76550174 CTGTCCCCATCATTGTATTTTGG - Intronic
994090049 5:95801962-95801984 CTGAACACACCATTGTTTTTGGG + Intronic
994176450 5:96717229-96717251 CTGAACCATGCATTCTGTGTTGG - Intronic
994968660 5:106707470-106707492 CTGAACACAGAATTCTGTATTGG + Intergenic
996179381 5:120400147-120400169 CTGTACCCTTCATTGTGTCTAGG + Intergenic
999697279 5:154198326-154198348 CTGTACCAAGCATTGTGTTTGGG - Intronic
999825686 5:155271570-155271592 CTCAGCCCAGCATTGTATTATGG - Intergenic
1000650458 5:163811852-163811874 GTCAACCCAGCATTCTTTTTTGG + Intergenic
1001082415 5:168677025-168677047 CAGAACCCAGCACTTTGTCTAGG - Intronic
1003053530 6:2800178-2800200 CTGTTCCCACCATGGTGTTTCGG - Intergenic
1003694830 6:8393932-8393954 CTGAACGCAGCATGGTATTCGGG - Intergenic
1004761440 6:18670988-18671010 CTGAGCCAAGCATTATGTTGTGG + Intergenic
1005197729 6:23308937-23308959 ATGAATCCAGCATTGTGGTCAGG + Intergenic
1007105015 6:39277767-39277789 CTGATTCCAGCACTGTGTTCTGG - Intergenic
1008473668 6:51912505-51912527 CTAAAGCCAGCACTGTGTCTAGG + Exonic
1008706080 6:54160766-54160788 CAGAACCCAACAATGTCTTTGGG - Exonic
1010103727 6:72143417-72143439 GTGAACCCAGTATTTTGCTTTGG - Intronic
1010807146 6:80250655-80250677 CTGAATGCAGAATTGGGTTTAGG + Intronic
1013011227 6:106122395-106122417 CTCTGCCCAGCATGGTGTTTTGG + Intergenic
1015929350 6:138341788-138341810 CTGAAATAAGAATTGTGTTTTGG - Exonic
1018239564 6:161759841-161759863 CTGAACCCAGTTTTATGTTCAGG - Intronic
1018256937 6:161930046-161930068 CTGAAGCCAGCATTCTCTCTTGG + Intronic
1018882017 6:167893456-167893478 ATGAGCTCAGCATTGTCTTTTGG + Intronic
1019448937 7:1086500-1086522 ATTAACACAGCATTCTGTTTAGG + Intronic
1020645755 7:10812219-10812241 CTGCTTCCAGAATTGTGTTTGGG - Intergenic
1021918574 7:25460351-25460373 CTGGACCCAGAATTGGGTTGGGG + Intergenic
1028795865 7:94903019-94903041 GTTAACCCATCATTGTGTCTGGG + Intergenic
1032439708 7:131933135-131933157 CTAAACCCGGCATGGTGTGTGGG - Intergenic
1042845159 8:73162598-73162620 CCCAACCCATCATTGTGTTTAGG - Intergenic
1042960078 8:74294031-74294053 GTGACGCCTGCATTGTGTTTTGG - Intronic
1043045475 8:75317699-75317721 ATGAACCCAGAATAGTGTGTAGG - Intergenic
1045568774 8:103348754-103348776 CAGAACCCAGCTCTGTTTTTAGG - Intergenic
1046258501 8:111733567-111733589 GTGAATTCAGCATGGTGTTTAGG + Intergenic
1046337258 8:112806552-112806574 TTGATCCCAGTATTGTGCTTAGG + Intronic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1049389346 8:142360106-142360128 CTGAACTCAGCAGAGTGCTTTGG - Intronic
1051099298 9:13502762-13502784 ATCAACCTATCATTGTGTTTGGG - Intergenic
1056105012 9:83338732-83338754 ATGAACCCAGCATTGCCCTTAGG + Intronic
1060849813 9:126865325-126865347 CAGAGCCCAGCAGTGTGTCTGGG - Intronic
1185626174 X:1483964-1483986 GGGAACCCAGCTTTGGGTTTAGG - Intronic
1192822136 X:74656785-74656807 CTCCACACAGCTTTGTGTTTTGG + Intergenic
1193968954 X:88026365-88026387 CTGATCCCAGCATTCTGCTATGG - Intergenic
1194135071 X:90130914-90130936 CTGTACCCCACATTGTGTCTTGG + Intergenic
1196794265 X:119489679-119489701 CTGAGCCCAGGATTGGGTGTGGG + Intergenic
1198810761 X:140534053-140534075 CTGAGCTCAGCACTGTGTTATGG + Intergenic
1199049680 X:143222350-143222372 CTTGTCCCACCATTGTGTTTTGG - Intergenic
1200391508 X:155950929-155950951 TTGAAGTCAGCATTGTGGTTGGG + Intergenic
1200480853 Y:3701005-3701027 CTGTACCCCACATTGTGTCTTGG + Intergenic