ID: 1124108562

View in Genome Browser
Species Human (GRCh38)
Location 15:26764773-26764795
Sequence GCTCCACGGCACTGCTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124108555_1124108562 27 Left 1124108555 15:26764723-26764745 CCCAGAAGTAAGTTGCACCAGAA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1124108562 15:26764773-26764795 GCTCCACGGCACTGCTGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 339
1124108557_1124108562 10 Left 1124108557 15:26764740-26764762 CCAGAAACTTGCAAACAAATGAA 0: 1
1: 0
2: 2
3: 36
4: 452
Right 1124108562 15:26764773-26764795 GCTCCACGGCACTGCTGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 339
1124108556_1124108562 26 Left 1124108556 15:26764724-26764746 CCAGAAGTAAGTTGCACCAGAAA 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1124108562 15:26764773-26764795 GCTCCACGGCACTGCTGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124108562 Original CRISPR GCTCCACGGCACTGCTGAGT GGG Intronic
901000116 1:6144787-6144809 CCTCCTCGGCACTGCTGTGTGGG - Intronic
901140192 1:7023984-7024006 GCGCCACGGCACTGCAGCCTGGG + Intronic
901668497 1:10839932-10839954 GGTCCTCAGCACTGCTGAGATGG + Intergenic
901757558 1:11450622-11450644 CCTCCAGGGCACAGCTGAGCAGG + Intergenic
902521262 1:17018188-17018210 ACTCCACAGCACTGCTGCCTTGG - Intergenic
903026127 1:20430879-20430901 GCTCCAGGGAATTGCTGATTCGG + Intergenic
903505802 1:23835005-23835027 GCTCCACTGCACTGCAGCCTGGG - Intronic
903558216 1:24208710-24208732 GCGCCACTGCACTACAGAGTAGG - Intergenic
904848207 1:33436759-33436781 GCTCAGTGGCAGTGCTGAGTTGG + Intergenic
905822267 1:41002801-41002823 TCTCCACTGCACTCCAGAGTGGG + Intronic
906362465 1:45175490-45175512 GCTCCACTGCACTGCAGCTTGGG - Intronic
906612424 1:47212561-47212583 GCTCCCCTGCACTGCTCAGCAGG + Intergenic
906681099 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG + Intergenic
907245081 1:53103309-53103331 GCTCCACGGCACTGCTGGGCAGG + Intronic
908908911 1:69049354-69049376 GCTCCATGCCACACCTGAGTGGG + Intergenic
909152814 1:72030235-72030257 GCACCACGGCACTGCAGCTTGGG - Intronic
909592575 1:77367369-77367391 GCTCCACTGCACTGCAGCCTGGG - Intronic
910337196 1:86148225-86148247 GCTCCACTGCACTCCAGACTGGG - Intronic
910386505 1:86689221-86689243 GCTCCACTGCACTGCAGCCTGGG - Intergenic
910812527 1:91253123-91253145 GCTCCATGTCACTCCTGGGTGGG - Intergenic
912280300 1:108305473-108305495 GCTCCATGTCACTCCTGGGTGGG + Intergenic
912287926 1:108388884-108388906 GCTCCATGTCACTCCTGGGTGGG - Intronic
913221019 1:116660525-116660547 GCGCCACTGCACTGCAGACTGGG - Intronic
913347693 1:117824911-117824933 GCTCCAAGGCACTAGGGAGTGGG + Intergenic
914910556 1:151782402-151782424 GCTCCACTGCACTCCAGTGTGGG + Intronic
914917603 1:151828007-151828029 GCCCCACGGAAATGCTGAGCAGG - Intronic
916493664 1:165326007-165326029 GCTCCCCGGCACTGCCCTGTTGG + Intronic
916594939 1:166234495-166234517 GCTCCACGTTACTCCCGAGTGGG + Intergenic
917878952 1:179314453-179314475 GCTCCCCAGGACTGCTGAGTGGG + Intronic
919896745 1:202013736-202013758 GCCCCAGTGCACTGCTGACTTGG - Intronic
921704840 1:218310789-218310811 GCTCCACTGCACTCCTGCCTGGG - Intronic
923101292 1:230819844-230819866 GCTTCACTCCACTGCAGAGTTGG - Intergenic
1063214001 10:3907583-3907605 GCTCCACTGCCCTCCTGAGTTGG + Intergenic
1063223965 10:3997282-3997304 GCACCACTGCACTGCTGCCTGGG - Intergenic
1064400713 10:15018784-15018806 GCACCACTGCACTCCAGAGTAGG - Intergenic
1064540263 10:16397847-16397869 GCATCACGGCACTCCAGAGTGGG + Intergenic
1065234018 10:23628434-23628456 GCACCACTGCACTGCAGCGTGGG + Intergenic
1065428555 10:25630872-25630894 GCACCACGGCACTCCTGCCTGGG - Intergenic
1066456852 10:35579906-35579928 TGTCCTCGGCAATGCTGAGTGGG - Intergenic
1067352442 10:45488503-45488525 TCTCCAGGGGAATGCTGAGTTGG - Intronic
1067946238 10:50691012-50691034 GCACCACTGCACTGCAGCGTGGG - Intergenic
1068898394 10:62234451-62234473 GCTCCACTGCACTCCAGACTGGG + Intronic
1068909484 10:62363628-62363650 GCGCCACTGCACTGCAGCGTGGG - Intergenic
1069971357 10:72172370-72172392 GCACCACTGCACTGCTGTCTGGG + Intronic
1070070462 10:73084333-73084355 GCTCCACTGCACTCCAGACTGGG - Intronic
1070161821 10:73871506-73871528 GCACCAGGGCTCTGCTGTGTGGG + Intronic
1070242645 10:74698594-74698616 GCTCCACTGCACTCCAGAATGGG - Intronic
1070572644 10:77651568-77651590 GCTCCATGGAACTCCAGAGTGGG - Intergenic
1070585215 10:77760186-77760208 GCTCCACTGCACTGCAGCCTGGG + Intergenic
1071626611 10:87178191-87178213 GCACCACTGCACTGCAGACTGGG + Intronic
1072302163 10:94071981-94072003 GCTCCAGGGCACTGTTCAGGAGG + Intronic
1072361665 10:94664790-94664812 GCTCCATGCCACTCCTGGGTGGG + Intergenic
1072399120 10:95079146-95079168 GCTCCACTGCACTCCAGACTGGG + Intergenic
1072860315 10:98997153-98997175 GCTCCACTGCACTGCAGCCTGGG - Intronic
1073782589 10:106856067-106856089 GCACCACGGCACTCCAGAATGGG - Intronic
1074514972 10:114158654-114158676 GCTCCACTGCACTCCTGCCTGGG + Intronic
1075261897 10:120970362-120970384 GGACCAAGGCACTGGTGAGTGGG + Intergenic
1075691780 10:124400705-124400727 GCGCCACGGCACTGCAGCCTAGG + Intronic
1076527043 10:131118419-131118441 GCTCCACTGAACTTCTCAGTAGG + Intronic
1078768054 11:14318668-14318690 GTTCCACTGCCCTGCTGAGCTGG - Intronic
1079202728 11:18389297-18389319 GCTCCACTGCACTCCTGCCTGGG - Intergenic
1083003773 11:59322080-59322102 GCACCACGGCACTGCAGTCTGGG - Intergenic
1085099869 11:73791457-73791479 ACTCCACTGCACTGCTGCCTGGG - Intronic
1086304062 11:85460479-85460501 GCTCCATGCCACTCCTGGGTGGG + Intronic
1087252612 11:95920348-95920370 GCACCACTGCACTCCAGAGTGGG - Intronic
1087564846 11:99841927-99841949 GCTCCACTGCACTCCTGTCTGGG - Intronic
1088575163 11:111264451-111264473 GCACCACTGCACTGCAGACTGGG + Intronic
1088619202 11:111664571-111664593 GCGCCACTGCACTGCAGCGTGGG + Intronic
1088800984 11:113306998-113307020 GCGCCACGGCACTCCAGCGTGGG - Intergenic
1089370507 11:117952422-117952444 GCTCCACTGCACTCCAGCGTGGG - Intergenic
1089532696 11:119141378-119141400 GATCCACGTCACTGATGGGTGGG - Intergenic
1089789764 11:120934245-120934267 GTGCTAGGGCACTGCTGAGTGGG + Intronic
1090717261 11:129441489-129441511 GCGCCACGGCACTGCAGCCTAGG - Intronic
1091321533 11:134655688-134655710 GCTCCTCTGCACTGCTCAGCTGG - Intergenic
1093110092 12:15141196-15141218 GCTCCACTGCACTGCAGCCTGGG - Intronic
1093833521 12:23796948-23796970 GCTCCACGCTACTGCACAGTAGG + Intronic
1094446831 12:30540218-30540240 GCTCCACTGCACTCCAGACTGGG - Intergenic
1095561059 12:43565669-43565691 GCTCTCAGACACTGCTGAGTGGG + Intergenic
1096373047 12:51084283-51084305 GCGCCACTGCACTGCAGACTGGG + Intergenic
1096421248 12:51459824-51459846 GCGCCACTGCACTCCAGAGTGGG + Intronic
1096468359 12:51860984-51861006 GCTCCACTGCACTCCAGACTGGG + Intergenic
1098144689 12:67486843-67486865 GCTCCACATCACTCCTGGGTGGG - Intergenic
1098691730 12:73497878-73497900 GCACCACTGCACTGCAGACTGGG + Intergenic
1099446052 12:82752861-82752883 ACTCCATGGCACAGCTGAGCAGG - Intronic
1099634870 12:85200860-85200882 GCTCCACTGCACTGCAGCCTGGG - Intronic
1100476678 12:94941521-94941543 GCTCCTGGGGACTGCTGAGCAGG + Intronic
1101307164 12:103540050-103540072 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1102021582 12:109687066-109687088 GCACCACGGCACTGCAGCCTGGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1104604070 12:130175219-130175241 GCCACACGGCACTGCTAAGCAGG + Intergenic
1105255928 13:18744160-18744182 GCTCCAGGGCACTGATGGGAAGG + Intergenic
1105505989 13:21010155-21010177 GCACCACTGCACTCCAGAGTAGG + Intronic
1105597651 13:21854560-21854582 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1106376080 13:29189708-29189730 GCTCCACCTCACAGCTGAGGTGG + Intronic
1106690238 13:32107312-32107334 GCACCACTGCACTCCAGAGTGGG + Intronic
1107191673 13:37595851-37595873 GCACCACTGCACTCCCGAGTGGG - Intronic
1110060382 13:71032654-71032676 GCTCCACACCACTCCTCAGTGGG - Intergenic
1110190466 13:72724579-72724601 GCGCCACTGCACTGCAGACTGGG - Intronic
1110282008 13:73704771-73704793 ACAGTACGGCACTGCTGAGTCGG - Intronic
1112366588 13:98760871-98760893 GTTCCATTGCACTGCTGGGTGGG - Intergenic
1113397404 13:109961368-109961390 GCTCCGGGGCAGGGCTGAGTGGG - Intergenic
1113723523 13:112579625-112579647 GCTCTCCCACACTGCTGAGTGGG + Intronic
1114573593 14:23693273-23693295 GTTCCATTGCACTGCTGGGTAGG - Intergenic
1117503204 14:56374632-56374654 GCTCCATGCCACTCCTGGGTGGG + Intergenic
1117560050 14:56928248-56928270 GCGCCACTGCACTCCAGAGTGGG + Intergenic
1119049983 14:71357768-71357790 GCACCACTGCACTGCAGCGTGGG - Intronic
1119284760 14:73443948-73443970 GCGCCACTGCACTCCTGCGTGGG - Intronic
1119619704 14:76122961-76122983 GCTCCACTGCACTCCAGACTGGG + Intergenic
1122749476 14:103921967-103921989 GCGCCACTGCACTGCAGCGTGGG - Intronic
1122986212 14:105212809-105212831 CCTCCAGGGCACAGCTGTGTGGG + Intronic
1123027203 14:105431666-105431688 GCGCCACTGCACTGCTGCCTGGG - Intronic
1124108562 15:26764773-26764795 GCTCCACGGCACTGCTGAGTGGG + Intronic
1125442190 15:39714928-39714950 GCACCACTGCACTGCAGACTGGG + Intronic
1125858404 15:42973929-42973951 GCTCCACTGCACTACAGACTGGG - Intronic
1126824342 15:52534199-52534221 GCTCCACTGCACTGCAGCTTGGG - Intergenic
1127043788 15:55004660-55004682 GCTCCAAGTCACTGCTGATGCGG - Intergenic
1127120217 15:55765585-55765607 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1127629473 15:60813498-60813520 GCTCCACCCCAGTGCTGAATGGG + Intronic
1128124796 15:65184722-65184744 GGTCCCCGGCAGGGCTGAGTGGG + Intronic
1128313407 15:66645531-66645553 GCGCCACTGCACTCCAGAGTGGG - Intronic
1129014978 15:72459041-72459063 GCACCACGGCACTCCTGCCTGGG - Intergenic
1129325562 15:74798656-74798678 CTTCCACGGCACTGCCGAGCAGG + Exonic
1129616972 15:77106404-77106426 GCTCCACTGCACTGCAGCCTGGG - Exonic
1132015194 15:98309216-98309238 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1132458224 16:35979-36001 GCTCGAGGGCAGAGCTGAGTTGG + Intergenic
1132522279 16:397300-397322 GCGCCACGGCTCGGGTGAGTGGG + Exonic
1132626008 16:891855-891877 GCTCCCCGTCACGGCTGTGTTGG + Intronic
1133280727 16:4663762-4663784 GCTCCCCAGCACTGCTCTGTGGG - Intronic
1133822766 16:9251379-9251401 GCGCCACTGCACTGCTGCCTGGG - Intergenic
1135016426 16:18927698-18927720 GCTCCACTGCACTCCAGCGTGGG + Intergenic
1137909370 16:52360916-52360938 CCTCCACAGCTCTGCTGGGTGGG - Intergenic
1138507680 16:57486333-57486355 GCTCCGCGGCGCCGCTGAGCAGG - Exonic
1138669857 16:58605091-58605113 GCGCCACTGCACTGCAGCGTAGG + Intronic
1138998027 16:62476958-62476980 GCTCCGTGTCACTCCTGAGTGGG + Intergenic
1139437610 16:66945387-66945409 GCACCACGGCACTCCTGCCTGGG + Intergenic
1139627134 16:68199171-68199193 GCGCCACTGCACTGCAGCGTGGG + Intronic
1140194292 16:72844145-72844167 GGTCCAAGGCACTGCTGACAGGG + Intronic
1140980101 16:80100365-80100387 GCACCACTGCACTGCAGACTGGG + Intergenic
1141587262 16:85042754-85042776 TGTGCACGGCACTGCTGAGAGGG - Intronic
1143670791 17:8394478-8394500 GCGCCACTGCACTCCTGACTGGG - Intronic
1144867456 17:18345721-18345743 GCTCCATTGCACTCCAGAGTGGG - Intronic
1145288704 17:21525931-21525953 GCTCCAGGGCAATGCTGTCTGGG + Intronic
1146202797 17:30874671-30874693 GCTCCACTGCACTGCTGCCTGGG - Intronic
1146599294 17:34200723-34200745 GCACCACTGCACTCCAGAGTGGG - Intergenic
1146646648 17:34580977-34580999 GCGCCACGGCAGCCCTGAGTTGG + Exonic
1146654429 17:34626764-34626786 GCTCCACGCCCCTGATGCGTCGG + Intronic
1146669914 17:34729984-34730006 GCTCCACTGCACTCCAGACTGGG + Intergenic
1146763491 17:35498094-35498116 GCTCCAGGACACAGCTGAGCCGG + Intronic
1149614089 17:57983318-57983340 GCTCCACGGCAGAGCTCAGGAGG + Exonic
1149822067 17:59789490-59789512 GCTCCACTGCACTCCAGCGTGGG + Intronic
1151300608 17:73222153-73222175 GCACCACGGCACTCCTGCCTAGG + Intronic
1151459080 17:74244036-74244058 GCTCTGCGGCAGTGGTGAGTTGG + Exonic
1151519158 17:74616039-74616061 GCTCCACGGCACTCCAGCCTGGG + Intronic
1151648781 17:75452556-75452578 GCTCCACTGCACTGCAGCCTGGG - Intronic
1151834963 17:76576607-76576629 CCTACATGGCTCTGCTGAGTTGG + Intronic
1151856406 17:76725361-76725383 GCACCACGGCACTGCAGCCTGGG + Intronic
1152269933 17:79318444-79318466 GCTCAACTGCATTGCTGAGAGGG - Intronic
1152439429 17:80296724-80296746 GCTCCACTGCACTCCAGACTGGG - Intronic
1153213219 18:2790716-2790738 GCACCACTGCACTGCTGTCTGGG + Intronic
1154435105 18:14336529-14336551 GCTCCAAGGCACTGATGGGAAGG - Intergenic
1154940169 18:21104552-21104574 GCGCCACGGCACTTCGGACTGGG + Intronic
1163021978 19:14486752-14486774 GCACCACTGCACTGCTGCTTGGG - Intronic
1163929650 19:20376737-20376759 GCACCACTGCACTGCAGAGATGG + Intergenic
1164034447 19:21440466-21440488 GCTCCGTTGCACTGCTGGGTAGG + Intronic
1165458406 19:35928785-35928807 GCACCACTGCACTGCAGCGTGGG - Intergenic
1165910417 19:39222677-39222699 GCACCACTGCACTGCAGACTGGG + Intergenic
1165990569 19:39810013-39810035 GAGCCACTGCACTGCTGATTTGG - Intergenic
1166132237 19:40752707-40752729 GCACCACTGCACTGCTGCCTGGG + Intronic
1166594620 19:44034588-44034610 GCCTCACTGGACTGCTGAGTTGG + Intergenic
1167554047 19:50181842-50181864 GCACCACTGCACTGCAGCGTGGG - Intergenic
1167822360 19:51940262-51940284 GCTCCTCGGCCCTGCTCAGAAGG + Exonic
1168332150 19:55577068-55577090 GCACCACGGCACTGCAGCTTGGG + Intergenic
927167078 2:20334268-20334290 GCTCCACTGCACTCCAGATTGGG + Intronic
927837489 2:26411752-26411774 GCTCCACTGCACTGCAGCCTGGG + Intronic
928883552 2:36123276-36123298 GCTCCGCGCCACTCCTGGGTGGG + Intergenic
929066330 2:37978733-37978755 TCACCACTGCACTGCAGAGTGGG + Intronic
929778689 2:44943911-44943933 GCTCCACGGCAGGGGTGAGAGGG - Intronic
931275078 2:60737424-60737446 GCTCCACTGCACTGCAGACTGGG - Intergenic
931310580 2:61076034-61076056 GCTCCACTGCACTCCAGACTGGG - Intronic
932770353 2:74497713-74497735 GCTCCACGGCACTCCAGCCTGGG + Exonic
934668633 2:96192458-96192480 GCTCCACAGCACTGGTAAGGAGG + Exonic
934880187 2:97970247-97970269 GCCCCAAGGAACTGCTCAGTAGG + Intronic
935573314 2:104685513-104685535 GCACCACGGCACTGCAGCCTGGG + Intergenic
936036832 2:109120096-109120118 GCTCCAAGGCCATGCAGAGTGGG + Intergenic
937568831 2:123332817-123332839 GCTCCATGTCACTCCTGGGTGGG - Intergenic
937933427 2:127222866-127222888 GCTCCACTGCACTCCTGCCTGGG - Intergenic
938021443 2:127908866-127908888 GCGCCACTGCACTGCAGCGTGGG + Intergenic
938056484 2:128219468-128219490 GCACCACGGCACTGCAGCGTGGG - Intergenic
938142933 2:128811602-128811624 TCCTCACGGCACTGCTGAGAAGG + Intergenic
938320207 2:130357143-130357165 GTTCCACTGCACAGCTGAGATGG + Intronic
939015321 2:136896986-136897008 GCACCATGGCACTCCAGAGTGGG - Intronic
939081743 2:137670876-137670898 GCGCCACTGCACTGCAGCGTGGG + Intronic
939508492 2:143077191-143077213 GCACCACTGCACTCCAGAGTGGG - Intergenic
941511761 2:166419398-166419420 GCTCCACTGCACTCCAGACTGGG - Intronic
943029780 2:182671660-182671682 GCTCCACTGCACTGCAGCCTGGG - Intergenic
943699355 2:190973021-190973043 GCTCCACAGGACTGCAGAGAGGG + Intronic
943933065 2:193879395-193879417 GCACCACTGCACTCCAGAGTGGG + Intergenic
947422116 2:229950381-229950403 ACTCCACGGCACTCCAGACTGGG + Intronic
947423363 2:229960531-229960553 GCACCAGTGCACTGCTGTGTGGG - Intronic
949028893 2:241779274-241779296 GCTCCACTGCACTCCAGACTGGG - Intronic
1170024856 20:11878324-11878346 GCTCCACGGCACTCCAGCTTGGG - Intergenic
1172086893 20:32392323-32392345 GCGCCACTGCACTCCAGAGTGGG - Intronic
1172523910 20:35585991-35586013 GCTCCACTGCACTCCAGACTGGG + Intergenic
1173845481 20:46185820-46185842 GCACCACTGCACTGCTGCCTGGG + Intronic
1175090650 20:56500722-56500744 GCTGGACTGCCCTGCTGAGTGGG + Intronic
1175471941 20:59236497-59236519 GCACCACTGCACTCCAGAGTGGG - Intronic
1175879458 20:62248731-62248753 GCTCCACTGCACTCCAGAGAGGG - Intronic
1176841931 21:13849173-13849195 GCTCCAGGGCACTGATGGGAGGG + Intergenic
1178702129 21:34842450-34842472 GCTCCACTGCACTCCAGACTGGG + Intronic
1179538999 21:42072003-42072025 GCTCCACTGCACTGCAGCCTGGG + Intronic
1179778057 21:43680601-43680623 GCTCCACTGCACTGCAGCCTGGG - Intronic
1180030648 21:45204582-45204604 GCTCCACGAAAATGCTGAGCAGG - Exonic
1180082758 21:45494185-45494207 GCTCCAATGCACAGCTGGGTGGG - Intronic
1180098430 21:45572627-45572649 GCTCCACGGCACTCCAGCCTGGG - Intergenic
1180675431 22:17583030-17583052 GCTCCACTGCACTTCGGCGTGGG + Intronic
1180822546 22:18840735-18840757 GCACCACTGCACTGCGGACTGGG - Intergenic
1181190417 22:21135292-21135314 GCACCACTGCACTGCGGACTGGG + Intergenic
1181208785 22:21275231-21275253 GCACCACTGCACTGCGGACTGGG - Intergenic
1181576672 22:23799725-23799747 GCGCCACTGCACTCCAGAGTGGG - Intronic
1181577993 22:23808161-23808183 GCGCCACTGCACTCCAGAGTGGG - Intronic
1183520623 22:38294381-38294403 GCTCGGCGGCACTGCGGAGCCGG + Exonic
1183809140 22:40239158-40239180 GCGCCACGGCACTGCAGCGTGGG + Intronic
1183980329 22:41535925-41535947 GCACCACTGCACTGCAGCGTGGG + Intronic
1184529816 22:45048176-45048198 GCTCCACTGCACTCCTGCCTGGG - Intergenic
1203218154 22_KI270731v1_random:20215-20237 GCACCACTGCACTGCGGACTGGG + Intergenic
1203272686 22_KI270734v1_random:66640-66662 GCACCACTGCACTGCGGACTGGG - Intergenic
950442015 3:13015783-13015805 GCCCCCAGGCACTGCTGAGGGGG + Intronic
950687976 3:14632464-14632486 GCTCCACCACTCTCCTGAGTTGG + Intergenic
950804590 3:15588548-15588570 GCGCCACTGCACTGCAGATTGGG + Intronic
951611211 3:24494678-24494700 GCTCCAGGGCACTGGTAATTTGG - Exonic
952432561 3:33238245-33238267 GCACCACGGCACTCCTGCCTGGG - Intergenic
954624815 3:52016664-52016686 CCTCCAGGGCCCTGCAGAGTGGG - Intergenic
955058656 3:55477541-55477563 GCTGCACGGCACTACTGTCTGGG - Intronic
955067284 3:55544239-55544261 GCTCCAGGGCCCTGCTGCTTGGG + Intronic
956302957 3:67792524-67792546 GCTCCACTGCACTCCAGACTGGG - Intergenic
958432841 3:94062674-94062696 GCGCCACTGCACTGCAGCGTGGG - Intronic
958923499 3:100132358-100132380 GCACCACGGCACTGCAGCCTGGG + Intronic
960758872 3:121050034-121050056 GCTCCATGCCACTTCTGGGTGGG + Intronic
963219797 3:142796591-142796613 GCTCCAAGACTCTGCTGCGTGGG + Intronic
964035944 3:152196303-152196325 GCGCCACTGCACTCCGGAGTGGG + Intergenic
964152624 3:153546008-153546030 GCACCACTGCACTGCAGACTGGG - Intergenic
966265992 3:178044028-178044050 GCTCCACGGCACTCCAGCCTGGG + Intergenic
966269672 3:178090171-178090193 GCTCCATGTCACTCCTGGGTGGG - Intergenic
966915238 3:184580968-184580990 GCTCCACGGCATTGATGACCTGG - Exonic
967185116 3:186938029-186938051 GCACCACTGCACTGCAGACTGGG + Intronic
967384456 3:188897897-188897919 GCGCCACTGCACTGCTGCCTGGG - Intergenic
967529205 3:190529813-190529835 GCGCCACTGCACTCCAGAGTGGG + Intronic
967754801 3:193156888-193156910 GCTCCACGGCAGAGCTCAGGAGG + Intergenic
968437326 4:600547-600569 GCTCCGTGCCACTGCTGAGTGGG + Intergenic
968448167 4:662958-662980 GCACCACTGCACTCCAGAGTGGG + Intronic
969381464 4:6801639-6801661 GCTCCACTGCACTCCAGACTGGG + Intronic
971288142 4:25309659-25309681 GCTCCACTGCACTCCAGACTAGG + Intergenic
972045522 4:34661071-34661093 GCGCCACGGCACTACAGACTGGG - Intergenic
972245881 4:37244980-37245002 GCTCCACGGAACGGCTCAGCAGG - Exonic
975990188 4:80251064-80251086 GCTCCACTGCACTCCAGACTGGG + Intergenic
976298462 4:83495407-83495429 GCTCCACTGCACTCCAGACTGGG + Intronic
977261203 4:94799344-94799366 GCGCCACTGCACTGCAGACTGGG - Intronic
977279655 4:95023971-95023993 GCTCTACTGCAGTTCTGAGTAGG - Intronic
978006856 4:103627479-103627501 GCTCCACGGCACTCCAGCCTGGG + Intronic
979160641 4:117456700-117456722 GCACCACGGCACTGCAGCCTGGG - Intergenic
981221685 4:142244340-142244362 GCACCACTGCACTCCAGAGTGGG - Intronic
981313877 4:143322868-143322890 ACTCCACTGCACTCCAGAGTGGG - Intergenic
982830534 4:160054183-160054205 GCTCCACCGCACTCCAGACTGGG + Intergenic
984807629 4:183766264-183766286 TCTCCACGACACTGCTGACATGG - Intergenic
985209719 4:187579689-187579711 GCTCCACTGCACTGCAGCCTGGG + Intergenic
985226611 4:187768163-187768185 GCACCACGGCACTCCAGTGTAGG - Intergenic
988782108 5:34531709-34531731 GCACCACTGCACTGCAGACTGGG + Intergenic
990168664 5:53022607-53022629 GCACCACTGCACTGCAGACTGGG - Intronic
991735626 5:69629446-69629468 GCACCACTGCACTGCAGCGTAGG - Intergenic
992300150 5:75369613-75369635 CCTCCACAGGACTGTTGAGTGGG + Intronic
992301123 5:75381395-75381417 GCACCACTGCACTCCAGAGTGGG - Intronic
993563028 5:89435574-89435596 GCTGCAAGGCACTGGTGTGTGGG - Intergenic
995169410 5:109090089-109090111 GCTCCTCAGCAGTGGTGAGTAGG - Intronic
996078201 5:119223097-119223119 GCACCACTGCACTGCAGACTGGG - Intronic
997017593 5:129954909-129954931 GCGCCACGGCACTGCAGCCTGGG - Intronic
998834386 5:146189982-146190004 GCTCCACTGCACTGCAGCCTGGG - Intergenic
999511304 5:152255526-152255548 CATCCACGGCACTGCAGAGGAGG - Intergenic
1000676883 5:164132331-164132353 GCTCCAGGACACTGCTCACTGGG + Intergenic
1002195630 5:177499443-177499465 GCTCCACTGCACTCCAGTGTGGG + Intergenic
1002619723 5:180479316-180479338 GCACCACTGCACTGCAGACTGGG + Intergenic
1003320413 6:5046187-5046209 GCACCACTGCACTGCAGCGTGGG - Intergenic
1003529987 6:6929130-6929152 GCACCACGGCACTGCAGCCTAGG - Intergenic
1004257301 6:14076833-14076855 GCACCACTGCACTGCAGCGTGGG + Intergenic
1004800542 6:19142140-19142162 GCTACACTGCACAGCTGAGGGGG - Intergenic
1005639601 6:27783478-27783500 GCTCCACTGCACTCCAGTGTGGG - Intergenic
1010199709 6:73272204-73272226 GCTCCACTGCACTCCAGCGTGGG - Intronic
1010964264 6:82185138-82185160 GCGCCACGGCACTGCAGCCTGGG + Intronic
1012388497 6:98709408-98709430 TCTCAACAGCACTGCTGACTAGG + Intergenic
1014357237 6:120427854-120427876 GCACCACTGCACTGCTGCTTGGG + Intergenic
1014525220 6:122494771-122494793 GCTCCACACCAGTTCTGAGTAGG - Intronic
1014987308 6:128027638-128027660 GCTCCACTGCACTCCAGACTCGG - Intronic
1015025780 6:128530863-128530885 GCGCCACGGCACTGCAGCCTGGG - Intergenic
1015597258 6:134877642-134877664 GCTCCACGGCACTCCAGCCTGGG - Intergenic
1015797705 6:137029462-137029484 GCTCCACTGCACTTCTGCCTGGG + Intronic
1017337839 6:153283066-153283088 GCATCACTGCACTGCAGAGTGGG - Intergenic
1017578759 6:155836804-155836826 GCTCCACCGCACTGCAGCCTGGG + Intergenic
1017674757 6:156801241-156801263 GCACCACTGCACTCCAGAGTGGG - Intronic
1018753124 6:166825048-166825070 GCTCTGCAGCACTGCTGTGTGGG - Intronic
1020176003 7:5882650-5882672 GGTACCCGGCACTGCTGAGTGGG + Intronic
1021618194 7:22524185-22524207 GCGCCACTGCACTGCAGCGTGGG - Intronic
1021714195 7:23446512-23446534 GCACCACTGCACTGCTGCCTGGG + Intronic
1021851402 7:24812262-24812284 GCACCACTGCACTTCAGAGTGGG + Intronic
1022694611 7:32692150-32692172 GCGCCACTGCACTGCAGCGTGGG - Intergenic
1022927791 7:35073650-35073672 GCGCCACTGCACTGCAGCGTGGG - Intergenic
1026354395 7:69544747-69544769 GCTCCATGGCACTCCAGACTGGG - Intergenic
1026357470 7:69571373-69571395 GCTCCACTGCACTCCTGCCTGGG + Intergenic
1026479964 7:70769640-70769662 GCTCCACTGCACTCCTGCCTGGG + Intronic
1026827360 7:73592931-73592953 GCACCACTGCACTGTAGAGTGGG - Intergenic
1028374487 7:90131927-90131949 GCGCCACTGCACTGCAGCGTGGG + Intergenic
1028791440 7:94857906-94857928 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1028978783 7:96943584-96943606 GCTCCACTGCACTGCAGCCTGGG + Intergenic
1029572577 7:101380032-101380054 GCACCACTGCACTCCTGACTGGG - Intronic
1032968455 7:137130975-137130997 GCTCCACGTTACTCCTGGGTAGG - Intergenic
1033290911 7:140081999-140082021 GCACCACTGCACTGCTGCCTGGG + Intergenic
1033977332 7:147117405-147117427 GCTCCACGTCGCTCCTGGGTAGG + Intronic
1035199513 7:157252091-157252113 GCTCCACTGCACTCCAGTGTGGG + Intronic
1035681576 8:1492625-1492647 GCTCCACGGCACCTCTTCGTGGG - Intergenic
1036091766 8:5673177-5673199 GCTCCACTGCACTGCAGCCTGGG + Intergenic
1036120736 8:6014476-6014498 GCACCACTGCACTGCAGACTGGG + Intergenic
1037211328 8:16392111-16392133 GCACCACTGCACTGCAGACTGGG - Intronic
1038065199 8:23956734-23956756 GCTCCACGTCACTGCCGCATTGG + Intergenic
1038726915 8:30089724-30089746 GCTCCACTGCACTGCAGCCTGGG + Intergenic
1038822263 8:30963739-30963761 GCACCACTGCACTGCTGCCTGGG - Intergenic
1039636190 8:39168506-39168528 CCTCCAGGGGAATGCTGAGTTGG + Intronic
1039637185 8:39179701-39179723 GCTCCATGCCACTCCTGGGTGGG + Intronic
1040039529 8:42902312-42902334 GCTCCACGGCACTCCAGCCTGGG - Intronic
1041056621 8:53992566-53992588 GCACCACTGCACTCCAGAGTGGG + Intronic
1043103317 8:76075083-76075105 TCTCCAGGGCTCTGCTGATTAGG - Intergenic
1043933155 8:86113437-86113459 GCACCACGGCACTCCTGCCTGGG + Intronic
1044219679 8:89654957-89654979 GCACCACGGCACTCCAGACTGGG + Intergenic
1044979089 8:97697073-97697095 GCTCCACTGCACTCCAGACTGGG + Intronic
1046910581 8:119621969-119621991 GCGCCACAGCACTCCAGAGTGGG - Intronic
1048450431 8:134528732-134528754 GCTCCAGGGCACAGCTGAAGGGG + Intronic
1049513614 8:143042395-143042417 GCTCCAGGGAACATCTGAGTAGG - Intronic
1052262954 9:26539196-26539218 GCTCCATGTCACTCCTGGGTGGG - Intergenic
1052917061 9:33931497-33931519 GCTCCACGGCACTCCTGCTGAGG + Intronic
1055363726 9:75522656-75522678 GCTCCACTGCACTGCAGCCTGGG - Intergenic
1056627326 9:88264346-88264368 GCTCCACTGCACTGCAGTTTGGG + Intergenic
1056907680 9:90667174-90667196 GCTCCATGTCACTCCTGGGTGGG + Intergenic
1057918835 9:99079613-99079635 GTTCCTCGGCACTTCTGAGCTGG + Intergenic
1059232026 9:112729467-112729489 GCACCACGGCACTCCTGCCTGGG - Intergenic
1060806148 9:126578563-126578585 GCGCCACGGCACTGCAGCCTCGG - Intergenic
1185704058 X:2253287-2253309 GCGCCACGGCACTGCAGCCTGGG + Intronic
1185867068 X:3633518-3633540 GCACCACTGCACTCCTGACTGGG + Intronic
1190692306 X:52921610-52921632 GCGCCACTGCACTGCAGCGTGGG - Intergenic
1190701158 X:52990739-52990761 GCTCCACTGCACTCCAGAGTGGG + Intronic
1191889647 X:65926852-65926874 GCTCCATGTCACTGCAGGGTGGG + Intergenic
1192185030 X:68940930-68940952 GCTCCAGAGCACAGCTGAGCTGG - Intergenic
1194067994 X:89285147-89285169 GCTCCATGTCACTCCTGGGTAGG + Intergenic
1196834581 X:119802488-119802510 GCGCCACTGCACTGCTGCCTGGG - Intergenic
1197111659 X:122781908-122781930 GCTCCACTGCACTCCTGCGTGGG + Intergenic
1197925491 X:131642883-131642905 CCTCCACAGCTCTGCTGAGTTGG + Intergenic
1200722138 Y:6619308-6619330 GCTCCATGTCACTCCTGGGTAGG + Intergenic