ID: 1124111161

View in Genome Browser
Species Human (GRCh38)
Location 15:26789946-26789968
Sequence CCGTCTTAACAGCTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124111161_1124111167 5 Left 1124111161 15:26789946-26789968 CCTTCCTCCAGCTGTTAAGACGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1124111167 15:26789974-26789996 GAGTTTTTTTTTTTTTCTTCTGG 0: 1
1: 9
2: 163
3: 1691
4: 10365
1124111161_1124111169 9 Left 1124111161 15:26789946-26789968 CCTTCCTCCAGCTGTTAAGACGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1124111169 15:26789978-26790000 TTTTTTTTTTTTCTTCTGGTGGG 0: 2
1: 31
2: 858
3: 4000
4: 43302
1124111161_1124111170 13 Left 1124111161 15:26789946-26789968 CCTTCCTCCAGCTGTTAAGACGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1124111170 15:26789982-26790004 TTTTTTTTCTTCTGGTGGGTTGG 0: 1
1: 4
2: 34
3: 529
4: 2374
1124111161_1124111168 8 Left 1124111161 15:26789946-26789968 CCTTCCTCCAGCTGTTAAGACGG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1124111168 15:26789977-26789999 TTTTTTTTTTTTTCTTCTGGTGG 0: 1
1: 68
2: 1879
3: 18149
4: 136569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124111161 Original CRISPR CCGTCTTAACAGCTGGAGGA AGG (reversed) Intronic
901935225 1:12621945-12621967 CCTGCTCAAGAGCTGGAGGAAGG - Intergenic
909830261 1:80180009-80180031 CCTTCTTAACTGATGGAGCAAGG - Intergenic
910223759 1:84916040-84916062 CCATAGTAACAGTTGGAGGAAGG - Intergenic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
922136542 1:222833023-222833045 CCATCTCTTCAGCTGGAGGAGGG + Intergenic
1062855789 10:778894-778916 CCGGCTTCACAGCTGGGGGGAGG + Intergenic
1065198496 10:23290118-23290140 CCATCTGAACAGCAGGAAGAAGG - Intronic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1079073990 11:17372126-17372148 CCGTCTTACCAGCTGCAGGATGG + Exonic
1083186265 11:61019606-61019628 ACCTCTTGACAGCTGGTGGAGGG + Exonic
1085176683 11:74493809-74493831 GCGTGTTAAAAGCTGGAGGGGGG + Intergenic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1089647047 11:119887150-119887172 CCATCTTCCCAGCTGGAGGGAGG + Intergenic
1090716141 11:129433187-129433209 TGGTCTTAGCAACTGGAGGAAGG - Intronic
1103906573 12:124330765-124330787 CCTTCATGACAGCTGGAGCAGGG + Intronic
1106584683 13:31046722-31046744 CCGTCTTCTCAGCTGAATGACGG - Intergenic
1110129876 13:71994117-71994139 TCTTTGTAACAGCTGGAGGAAGG - Intergenic
1113923158 13:113925794-113925816 CCTTCGTAACAGCTGGAAGGCGG + Intergenic
1114536671 14:23427296-23427318 CCTTCTCAATAGCTGCAGGAAGG + Exonic
1116622953 14:47229031-47229053 CACTCTTATCAGCTGGAGAATGG + Intronic
1121951102 14:98171823-98171845 CCGTTATCACAACTGGAGGAGGG - Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1133783884 16:8960576-8960598 GGGTCTGAACAGCTTGAGGAAGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141809125 16:86362684-86362706 CCGTCTTTCCACCTGGAGCAGGG + Intergenic
1141918743 16:87120591-87120613 CCATCTTTGCAGCTGGAGAAAGG + Intronic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1153014943 18:575129-575151 GAGACTTAACAGCTGGAAGAGGG - Intergenic
1153592213 18:6685502-6685524 CCGTCTTTCCTGCTGGATGATGG + Intergenic
1156305218 18:35873032-35873054 CCTTCTTACCAGCTTGGGGATGG + Intergenic
1160983603 19:1827614-1827636 CCGTCTTTGCAGCTGGGGGCAGG + Exonic
1162387245 19:10367197-10367219 GCGTCTTACCACCTTGAGGAGGG + Intronic
1163600358 19:18245529-18245551 CCATTTTAACAGCCGGGGGAAGG - Intronic
1163782273 19:19256818-19256840 CCATGGTTACAGCTGGAGGAGGG + Exonic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1168411620 19:56143806-56143828 ACGTCTTAGCAACTGGGGGAAGG + Intronic
1168582372 19:57566282-57566304 CCATCTTACCAGCTCCAGGATGG - Intergenic
925723213 2:6847811-6847833 CTCCCTTAACAGCTGGAGGTGGG - Intronic
926154769 2:10447883-10447905 CCGTCTTCACAGCTCGGGGCTGG - Intronic
929279318 2:40060840-40060862 AGCTATTAACAGCTGGAGGAAGG - Intergenic
929446002 2:42001921-42001943 CAGGCTGAACTGCTGGAGGAAGG - Intergenic
931384249 2:61783004-61783026 CCTTCTTAACAGCCTAAGGAAGG + Intergenic
932076485 2:68669208-68669230 ACGTCTTAACAGCTGGAATGAGG - Intergenic
933398905 2:81766190-81766212 CCATCTTCACAGCTGCAGAATGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939533439 2:143393940-143393962 CATTCTTATGAGCTGGAGGATGG + Intronic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1170354666 20:15479119-15479141 CCTTCTTGACATCTGAAGGATGG + Intronic
1170426662 20:16241923-16241945 ACTTCTTAACAGCAGAAGGATGG - Intergenic
1171135491 20:22691226-22691248 CCTCCTTAACAGCTGGTGGGTGG - Intergenic
1172444146 20:34984514-34984536 GCCTCCTAACAGCTGCAGGAGGG + Intronic
1175406889 20:58740795-58740817 CACTCTTAAAAGTTGGAGGAGGG + Intergenic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1181738223 22:24898589-24898611 CCTTCTTTCCAGCTGCAGGAGGG + Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1184285576 22:43469207-43469229 CCGTCTTACCTGCTGCAGGGAGG + Intronic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
966270662 3:178101011-178101033 ACAGATTAACAGCTGGAGGAGGG - Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
971252676 4:24986338-24986360 CCGGGCTAACAGCTGGAGGGAGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972052268 4:34752221-34752243 CCATCTTAACAGATGCATGATGG - Intergenic
983275059 4:165606905-165606927 TGGGCTTAACAGCTGGATGATGG - Intergenic
987011413 5:13770045-13770067 CCATCAGAACAGCTGTAGGAAGG + Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
999780438 5:154845451-154845473 CCGTCTTAAGAACTGGAAGTTGG + Intronic
1002716882 5:181233625-181233647 ACCTCTTCACACCTGGAGGAAGG - Exonic
1002762972 6:216076-216098 CATTCTTAACAGCTGGACAATGG + Intergenic
1006101291 6:31687823-31687845 GCCTCCTCACAGCTGGAGGAAGG - Exonic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019917522 7:4143327-4143349 GGGTCTTGCCAGCTGGAGGAGGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1023951183 7:44847678-44847700 CCGTCTTAGAAGGAGGAGGACGG - Intronic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1030423113 7:109334196-109334218 CAGTATTAACAGCTGTATGACGG + Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032319133 7:130868737-130868759 CTGTTTTAACAGCTGTAGAATGG + Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043654044 8:82639641-82639663 CCGTCATAACAGATGGTGGCAGG - Intergenic
1048426588 8:134329156-134329178 CCGTGGTAGCTGCTGGAGGAGGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049276169 8:141721127-141721149 CCGAGCTAACAGCTTGAGGAAGG - Intergenic
1050016111 9:1236200-1236222 CACTTTCAACAGCTGGAGGATGG - Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1056435150 9:86568724-86568746 GGGTCTCAACAGCTGGGGGATGG + Intergenic
1057207383 9:93181815-93181837 CCGTCTTAGCAGCAGGGAGATGG + Intergenic
1057367129 9:94433092-94433114 CCGTCTCAAGGGCTGCAGGAAGG - Intronic
1057656207 9:96954978-96955000 CCGTCTCAAGGGCTGCAGGAAGG + Intronic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1185499485 X:585734-585756 CCGTCTTAATAGCCGGAGACAGG - Intergenic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1200947171 Y:8855179-8855201 CTGACTTAACAGCTGGCAGATGG + Intergenic
1202027560 Y:20540730-20540752 CCATCTTACCAACTGCAGGAAGG + Intergenic