ID: 1124111195

View in Genome Browser
Species Human (GRCh38)
Location 15:26790259-26790281
Sequence ACATTGCCACAGATGCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124111191_1124111195 7 Left 1124111191 15:26790229-26790251 CCAAATAACAAACATTCCACAGA 0: 1
1: 0
2: 3
3: 17
4: 282
Right 1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 113
1124111192_1124111195 -9 Left 1124111192 15:26790245-26790267 CCACAGACCCAAGCACATTGCCA 0: 1
1: 0
2: 0
3: 57
4: 360
Right 1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124111195 Original CRISPR ACATTGCCACAGATGCTCCG CGG Intronic
900092783 1:927646-927668 TCATGGTCACAGATGCTCCGGGG + Intronic
900737654 1:4309177-4309199 ACATTGCCACAGGTGGCCAGGGG - Intergenic
900793457 1:4693933-4693955 ACATTTCCACAGAAGCTTCTGGG + Intronic
904229112 1:29052319-29052341 ACATTGCCAGATATTCTCTGGGG + Intronic
904874395 1:33643103-33643125 ACATGGACACAGATGCTTCCTGG + Intronic
905187840 1:36209508-36209530 ACATTGCCAAATATCCTCTGGGG + Intergenic
907599084 1:55748617-55748639 ACATTGCCACACATCCTTTGTGG + Intergenic
911287724 1:96017740-96017762 ACATTGCCAAATATTCTCCAAGG + Intergenic
916064867 1:161128202-161128224 ACATTGCCACATATTCCCCAGGG - Intronic
916862756 1:168824051-168824073 ACATGGCCACATATGCTACATGG - Intergenic
1071017817 10:81019254-81019276 ACATTGCCAAATATCCTCCGTGG - Intergenic
1071204628 10:83259829-83259851 ACATTGCCAAATATCCTCTGGGG + Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078558564 11:12351338-12351360 ACATTGCCAAATATCCTCTGAGG - Intronic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1081531958 11:43968035-43968057 ACATTGCCAAATATCCTCAGAGG - Intergenic
1081546179 11:44073547-44073569 ACATTGCCACACATCCCCAGGGG - Intronic
1085759714 11:79231651-79231673 AAATTGCCACAACTGCTCTGAGG - Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1090541666 11:127712706-127712728 CCATTTCCACAAATGCTCCCTGG + Intergenic
1090701566 11:129300595-129300617 AGAGTGCCACAGATGCTCCTGGG + Intergenic
1090765621 11:129873797-129873819 ACATTGCCACAGATGCCAGCAGG - Exonic
1093337210 12:17920876-17920898 ACATTGGCACAGATGCTGCCTGG + Intergenic
1105249615 13:18686089-18686111 ACAATGGCACAGATGCTCTTGGG - Intergenic
1108228833 13:48317656-48317678 ACACTGCCACTGGTGCTCCTGGG + Intronic
1110146177 13:72193093-72193115 ACATTGCCAAATATCCTCTGGGG - Intergenic
1111432479 13:88161883-88161905 CCATTGCCACATAAGCTCCATGG + Intergenic
1119840440 14:77788746-77788768 ACATTGCCAAAGATCCCCTGGGG + Intergenic
1121413836 14:93765167-93765189 ACATGGCCCCACATGCTCCCAGG + Intronic
1121636257 14:95455701-95455723 ACATTGCCAAAGATTTTCCCAGG - Exonic
1121851610 14:97226507-97226529 ACACTGTCACAGATGCACCTAGG - Intergenic
1122006629 14:98710177-98710199 ACATTACCACAGACGCTCTCTGG - Intergenic
1123988388 15:25665215-25665237 ACTTTTACACAGATGCTCCTTGG - Intergenic
1124077185 15:26457300-26457322 ACATTGACTCAGATGCTCCTTGG + Intergenic
1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG + Intronic
1126543524 15:49847052-49847074 ACAGTGCCACCCATGCTCCCAGG + Intergenic
1126796530 15:52264427-52264449 ACAGTGCCCCAGATGCCCCTGGG - Intronic
1128286539 15:66441593-66441615 ACAATGCTACTGATGCTCAGAGG - Intronic
1129703222 15:77779994-77780016 AGAGTGCCACAGAAGCTCAGAGG + Intronic
1132798153 16:1735871-1735893 ACAGTCACACAGATGCTCCATGG - Intronic
1135598698 16:23763348-23763370 ACATTATGACAGATGCTTCGTGG + Intergenic
1138269445 16:55684728-55684750 ATATTGCCAAATATCCTCCGGGG + Intronic
1138581209 16:57941481-57941503 ACATTGCCACAGCGGCTCCTGGG + Intronic
1139229961 16:65274057-65274079 ACATTCCCCCATATGCTCTGGGG + Intergenic
1139368160 16:66446627-66446649 ACATTCCCACACTTGCTCCCTGG - Intronic
1139927601 16:70499467-70499489 AGAATGCCACAGATGCTGGGTGG + Intronic
1143283225 17:5770516-5770538 ACAGTCCCACAGATGCACAGAGG + Intergenic
1143296650 17:5876322-5876344 CCATGGCCAAAGATGCTCCAGGG - Intronic
1144049911 17:11489733-11489755 ACATTGCCAAAGGTTCTCTGGGG - Intronic
1144352327 17:14409008-14409030 ACATTGACTCAGCAGCTCCGTGG - Intergenic
1145268168 17:21390385-21390407 CCACTGGCACAGAAGCTCCGTGG - Intronic
1152187759 17:78868873-78868895 ACATTGCCACATGTGCCCAGGGG - Intronic
1157489939 18:48116143-48116165 ACAGTGGCACAAATGCTCCCTGG + Intronic
1157717208 18:49896173-49896195 AAAATGCCACAGATGCTGTGGGG + Intronic
1160227003 18:77019390-77019412 ACACAGCCACAGATGCACAGGGG + Intronic
1161550548 19:4910003-4910025 CCATTGGCCCAGATGCTCCCGGG - Intronic
1163260493 19:16186790-16186812 ACATTGCCACATGTGCTTCGGGG - Intronic
1163644830 19:18483251-18483273 TCATGACCACAGATGCTCCCTGG + Intronic
926476641 2:13330345-13330367 AGATTGCCTCAGATGATCCAAGG - Intergenic
926489390 2:13505301-13505323 AGATTGCTACAGATGGTCCCTGG - Intergenic
928117123 2:28553650-28553672 ACACTGCTACAGATGCTCCTAGG - Intronic
929122051 2:38491424-38491446 ACATTGCCACAGCTGTGCAGAGG - Intergenic
931605428 2:64047975-64047997 ACAATGCCACAGATTCTACAAGG + Intergenic
932275933 2:70452336-70452358 ACAGAGCCACTGATGCTCCGAGG + Intronic
932591897 2:73072357-73072379 AAAATCCCACAGAGGCTCCGTGG + Intronic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
934496169 2:94801766-94801788 ACATTGACACTGATACTCCCAGG - Intergenic
935308188 2:101758517-101758539 CAATTCCCACAGATGCTCTGTGG - Intronic
938159600 2:128973461-128973483 ACATGGCCACAGAGGCCCTGGGG - Intergenic
939172377 2:138710921-138710943 ACATTAGCACAGATGCTGAGTGG - Intronic
944777571 2:202982692-202982714 ACATTACCACAGATTTTCCATGG - Intronic
946270059 2:218584407-218584429 ACATTGCCACATGTCCTCCAGGG + Intronic
946882929 2:224194336-224194358 ACATTGAATCAGATGCTCCCAGG - Intergenic
947585952 2:231357099-231357121 ACATTGCAGCAGCTGCTCCTTGG - Intronic
1169795208 20:9454998-9455020 ATATTGCCACATGAGCTCCGAGG - Intronic
1175539850 20:59741480-59741502 ACATTGCCCCAGATGCCTCCTGG - Intronic
1177650196 21:23950369-23950391 ACTTTGCCAAATATCCTCCGGGG - Intergenic
1178042205 21:28651720-28651742 ACATTACCAGAGATTCTCTGAGG - Intergenic
1183342145 22:37287323-37287345 GCATTCCTACAGATGCTCCAAGG - Intronic
1184385768 22:44173749-44173771 ACATTGCCAAAGATCCCCCAAGG - Intronic
1184476032 22:44721948-44721970 ACTTTGAGACAGATGCTGCGTGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
955927734 3:64024130-64024152 ACATTGCTACAGATCTTCAGAGG + Intergenic
955984620 3:64559720-64559742 ACCTTGCCACATATGCACTGAGG - Intronic
958462063 3:94411104-94411126 ACATTGCCAAATATGCCCTGTGG - Intergenic
961615072 3:128172779-128172801 ACTTTGCTGCAGATGCTCCAAGG - Intronic
961714592 3:128849786-128849808 ACATGGCCACTGATGCACCCAGG - Intergenic
969182320 4:5451776-5451798 ACATTGCCACATATCCCCTGGGG + Intronic
969314370 4:6372636-6372658 CCATTGGCAAAGATCCTCCGAGG + Exonic
971145704 4:23974234-23974256 ACATTGTCACAGATGGTTTGCGG - Intergenic
972588740 4:40463886-40463908 ACATTGCCATATATGATGCGTGG + Intronic
972816943 4:42656116-42656138 ACTGAGCAACAGATGCTCCGGGG - Intronic
986157909 5:5195305-5195327 GCATTGGCACAGATGCACCAAGG + Intronic
995014721 5:107297213-107297235 ACATTGCTACATTTGCTCCTTGG - Intergenic
998984801 5:147744404-147744426 AAATTGCCAAAGATTCTCCAAGG + Intronic
999378714 5:151105026-151105048 ATATTGCCAAATATCCTCCGGGG + Intronic
1008377109 6:50804610-50804632 ACATTTCCAGATATGCTCAGGGG + Intergenic
1009543469 6:64995923-64995945 ACACTGCCACAGATATTCTGTGG - Intronic
1015794570 6:136998098-136998120 ACATTGCCACATATCCCCTGGGG + Intergenic
1016660318 6:146570351-146570373 AGATTGCCACAGAGCCTCCCAGG + Intergenic
1020698989 7:11453533-11453555 ACATTACAACAGATGTTCCTTGG + Intronic
1021058579 7:16081232-16081254 ACATAGCCATAGAAGCTCAGAGG - Intergenic
1021248610 7:18295756-18295778 ACATTGCCAAATGTGCTCTGGGG - Intronic
1022262633 7:28721143-28721165 ATATTGCCACATATCCCCCGGGG - Intronic
1022788539 7:33663541-33663563 ACATTGCCAAATATGCCCTGGGG - Intergenic
1023321844 7:39006610-39006632 ACTTAGCCACAGATCTTCCGTGG - Intronic
1026137839 7:67679113-67679135 ACTTTGCCACAGATGAGCTGCGG + Intergenic
1028853037 7:95557944-95557966 ACATTTCCTCAGATCCTCCTGGG - Intergenic
1032059861 7:128715423-128715445 ACATTTCTACACATGCTCAGGGG - Exonic
1032241454 7:130162379-130162401 ACATTGCCCCAAATGCTGCAGGG - Intergenic
1032754957 7:134880873-134880895 TCATTGCTACAGATGCTCAGCGG + Intronic
1034409811 7:150934449-150934471 ACATTGCCACACATGCCTGGGGG + Intergenic
1044294306 8:90510053-90510075 ACATTGCCAAATATCCTCTGGGG - Intergenic
1045383528 8:101649349-101649371 ACAATTCCACAGCTGCTCCAGGG - Intronic
1047590687 8:126323797-126323819 ACATTGCCAAATATCCCCCGAGG + Intergenic
1047727205 8:127694292-127694314 ACAGTGCCACAGCTCCTCCTTGG - Intergenic
1049283089 8:141760498-141760520 TCAGTGCCACAGACGCTCCCAGG + Intergenic
1050805175 9:9667857-9667879 ACCTTGCCACAAATGGTCTGGGG + Intronic
1055759219 9:79588966-79588988 ACATTGCCAGACATCCTCTGAGG - Intronic
1059423272 9:114205858-114205880 AGATGGCCACAGGTGCCCCGAGG + Intronic
1186398846 X:9238087-9238109 ACATTGCCAAACATCCTCTGGGG + Intergenic
1186759157 X:12705068-12705090 ACATTGCCAAATGTGCTCCCGGG + Intronic
1192169133 X:68843543-68843565 ACACTCCCACAGCTGCTCCCAGG - Intergenic
1193386268 X:80875321-80875343 ACATTGCCAAATATCCTCTGGGG + Intergenic
1200761316 Y:7041815-7041837 AGACTTCCACAGATGCTCAGTGG + Intronic