ID: 1124116619

View in Genome Browser
Species Human (GRCh38)
Location 15:26849397-26849419
Sequence TGTCCATTTTACAAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124116618_1124116619 -5 Left 1124116618 15:26849379-26849401 CCATAAAGTAAACATTGTTGTCC 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1124116619 15:26849397-26849419 TGTCCATTTTACAAAGAGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 323
1124116617_1124116619 12 Left 1124116617 15:26849362-26849384 CCACTGGAACATAAGCTCCATAA 0: 1
1: 4
2: 37
3: 200
4: 730
Right 1124116619 15:26849397-26849419 TGTCCATTTTACAAAGAGCAAGG 0: 1
1: 0
2: 1
3: 20
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124116619 Original CRISPR TGTCCATTTTACAAAGAGCA AGG Intronic
904377860 1:30093074-30093096 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
904571804 1:31471588-31471610 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
906086903 1:43143957-43143979 CGTCCATTTTACCATGAGGACGG - Intergenic
906256153 1:44352183-44352205 TGTCTGTTTTACAAGGATCAGGG - Intronic
907060720 1:51421184-51421206 GTTTCATTTTACAAAGAGAAAGG - Intronic
908453685 1:64281227-64281249 TCTCCATTTTACAATGAGGGAGG - Intergenic
909235624 1:73149349-73149371 TGTCTATTTTCTAAAGAGCTGGG + Intergenic
909469945 1:76016369-76016391 TGTCCAGTCATCAAAGAGCATGG + Intergenic
909736280 1:78966601-78966623 TGTCCATTCCAAAAAGAGGAAGG - Intronic
910257615 1:85263644-85263666 TGTCCATTTTACAATCAACTGGG - Intergenic
910551837 1:88483748-88483770 TGTTCATTTCACAAATAGCTGGG - Intergenic
911478087 1:98398620-98398642 TTTCAATTTTAAAAAGAGAAGGG + Intergenic
911765122 1:101664989-101665011 TGGCTATTTTAAAGAGAGCAAGG - Intergenic
912176536 1:107164981-107165003 TGGCTATTTTAAAGAGAGCAGGG + Intronic
915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG + Intronic
915537113 1:156543441-156543463 TGTCAATTTCACAAAAAGGAAGG + Intronic
916264899 1:162881261-162881283 AGTCCATATTAAAAAGAGAAGGG - Intergenic
916352959 1:163872998-163873020 TGTTCATGTGACAGAGAGCAAGG + Intergenic
916411699 1:164552686-164552708 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
916687874 1:167163719-167163741 AGTCATTTTTACAAAGAGCTAGG - Intergenic
917273409 1:173303577-173303599 GTTCCATTTTATAAAGATCAAGG - Intergenic
917719205 1:177770036-177770058 TTTACATTTAACAAAGAGTAAGG + Intergenic
918772522 1:188580225-188580247 ATTCCAATTTACAATGAGCATGG + Intergenic
922039254 1:221880192-221880214 TATCCATTTTACAAAGAAAGAGG + Intergenic
922414300 1:225406495-225406517 TCTGCATTTTGCAAAGAGAATGG - Intronic
922491389 1:226019687-226019709 AATCCATTGTACAAAGAGCCAGG - Intergenic
923264434 1:232300634-232300656 TGTCCAAATTTCACAGAGCATGG + Intergenic
923491549 1:234488504-234488526 TGTCCATCAGCCAAAGAGCAAGG - Intergenic
924031405 1:239889201-239889223 TGTCTGATTTACATAGAGCACGG + Intronic
924734985 1:246747727-246747749 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1064184688 10:13151249-13151271 TCTGCATTTTAAAAAGTGCAAGG - Intergenic
1065491657 10:26288418-26288440 TGTCAATTTTCAAAAGAGGAAGG - Intronic
1066205117 10:33181387-33181409 TGTTCATATTACTAACAGCAAGG + Intronic
1068075729 10:52250714-52250736 TGTCCTTTCTAAAAATAGCAGGG + Intronic
1068707717 10:60095154-60095176 TGTTCTTTTCATAAAGAGCAAGG + Intronic
1070534332 10:77363887-77363909 AGTCCATTTTAAAAAGAACAGGG - Intronic
1070702669 10:78614918-78614940 TGTCCATTTTACAGATGGTAAGG - Intergenic
1071767172 10:88680357-88680379 TTTCTATTTTACAAAGGGAAAGG - Intergenic
1072598087 10:96894381-96894403 AGTACATTTTAGAAGGAGCAAGG + Intronic
1073202105 10:101744028-101744050 CTTCCTTTTTACAAACAGCATGG + Intergenic
1073424321 10:103447118-103447140 AGTGCCATTTACAAAGAGCATGG + Exonic
1074415253 10:113261871-113261893 AGTGCATTTTGCACAGAGCATGG + Intergenic
1074665680 10:115720539-115720561 TGTCAATATTAACAAGAGCAGGG - Intronic
1074708986 10:116161411-116161433 TTTCCATAATAAAAAGAGCATGG + Intronic
1075603779 10:123789812-123789834 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1075660168 10:124188274-124188296 TGGCCATTTTTGAAGGAGCAAGG + Intergenic
1078715279 11:13833863-13833885 CATCCATTTTACAAAGCACAGGG + Intergenic
1079623518 11:22585283-22585305 TGTACATTTTGCAAAGATTATGG - Intergenic
1079786310 11:24677513-24677535 TGCCTAATTTGCAAAGAGCAGGG - Intronic
1079896320 11:26123469-26123491 TGCTCATTTCACAAAGATCAAGG + Intergenic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1082708024 11:56517588-56517610 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1083150935 11:60791352-60791374 TGTGCATTTGGCAAAGAGGAGGG + Intronic
1084096540 11:66915191-66915213 ACTCCATTTCACAGAGAGCACGG + Intronic
1085473367 11:76772416-76772438 AGTCCATATTACACACAGCAAGG + Intergenic
1087807750 11:102573802-102573824 TGTCCATTTCACAAAGCAAATGG - Intergenic
1087924146 11:103900079-103900101 TGCCCATTTTACAATGTGCCAGG - Intergenic
1087992337 11:104759965-104759987 AGTACATTCTACAAACAGCAAGG + Intergenic
1088123449 11:106395980-106396002 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1088724576 11:112622767-112622789 TGTCCATATCACAAAGAGTGAGG + Intergenic
1088889120 11:114030862-114030884 TTTACATTTTACACAGTGCAAGG + Intergenic
1090311613 11:125746289-125746311 TGTCCATTTTGGAAAGAGGGAGG - Exonic
1090324413 11:125872154-125872176 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1090595828 11:128320150-128320172 TCTCCATCTTTCAAAGAGAATGG - Intergenic
1090953919 11:131497921-131497943 TGGCTATTTTAAAGAGAGCAAGG - Intronic
1091133178 11:133164043-133164065 TGCCTATTTCACAAAGGGCAGGG + Intronic
1092330724 12:7584427-7584449 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1092532288 12:9354439-9354461 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1092894337 12:12998577-12998599 TGTTCATTCTACATAGAGCTGGG + Intronic
1093370583 12:18359907-18359929 TATCCATTTAACCAACAGCATGG - Intronic
1094368169 12:29706288-29706310 TGTGCGTTTTCCTAAGAGCAAGG + Intronic
1095120904 12:38417400-38417422 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1095162120 12:38931154-38931176 TGGCTATTTTAAATAGAGCAGGG + Intergenic
1095501785 12:42847632-42847654 AGTACATTTTACTAAGAGAAAGG - Intergenic
1096472023 12:51884938-51884960 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1099109971 12:78546694-78546716 TTTCCAGCTTAAAAAGAGCATGG - Intergenic
1099338671 12:81398365-81398387 TGTCCATGTTTCTAAGAGGATGG - Intronic
1099719945 12:86347721-86347743 AGGCCATTTTACAAAGAGTCAGG + Intronic
1099996424 12:89784373-89784395 TGTCTATTCTACCAAGATCAGGG + Intergenic
1100023200 12:90096668-90096690 TTCCCATTTTACAAAGATAATGG + Intergenic
1101345870 12:103885618-103885640 TGTTCATGTTCCAAAGACCATGG + Intergenic
1103640915 12:122351524-122351546 TTTACAGTTAACAAAGAGCAAGG - Intronic
1103672867 12:122632619-122632641 TGTCGATTAGACAAAGACCAGGG - Intergenic
1104224665 12:126819847-126819869 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1104943815 12:132406846-132406868 TTCCCATTTAACAAAGAGCAGGG - Intergenic
1107580778 13:41782205-41782227 TGTCCATGTCACAAACACCATGG + Intronic
1108302200 13:49090054-49090076 TGTCCATGTGCCAAAGAGAATGG + Intronic
1109910125 13:68898589-68898611 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1110647278 13:77902620-77902642 TGGCTATTTTAAAAAGAGCAGGG - Intronic
1110720308 13:78753911-78753933 TATTCATTTTACAAATAGAATGG - Intergenic
1114912617 14:27219759-27219781 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1115726339 14:36221085-36221107 TGTGCACTTTAGAAAGAGCTTGG + Intergenic
1118288668 14:64501629-64501651 TGTCCATTTTAGCAATAACAGGG - Intronic
1120281754 14:82447544-82447566 TGCTCATTTTCCAAAGAGCCTGG + Intergenic
1120690199 14:87584341-87584363 TTTTCATTTTTCAAAGAGCTTGG - Intergenic
1122090427 14:99334837-99334859 TGGACATTTTACAAAGGCCAGGG - Intergenic
1122728380 14:103776259-103776281 TTATCATTTTACAAAGAGCAAGG + Intronic
1123510784 15:20997097-20997119 TGTTCAATTTACAAACAACATGG - Intergenic
1123568004 15:21570854-21570876 TGTTCAATTTACAAACAACATGG - Intergenic
1123604112 15:22006178-22006200 TGTTCAATTTACAAACAACATGG - Intergenic
1124116619 15:26849397-26849419 TGTCCATTTTACAAAGAGCAAGG + Intronic
1124421375 15:29526288-29526310 TGTCCATCTTCCAAAAACCAAGG + Intronic
1126133673 15:45369478-45369500 TGGCCATTTTACCAGAAGCAAGG - Exonic
1126682361 15:51214658-51214680 TGTCCATTTTACAAAAACATGGG - Intronic
1129760158 15:78124602-78124624 TGGGCATTTTACAAAGTGCTGGG - Intronic
1131319154 15:91369485-91369507 TGTCCCTCTTCCGAAGAGCAGGG + Intergenic
1132229750 15:100172648-100172670 TGGCTATTTTAAAGAGAGCAGGG - Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1132717169 16:1296993-1297015 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1133961182 16:10494963-10494985 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1135282267 16:21162709-21162731 TGTCCAATTTAAAAATAGCTTGG - Intronic
1135399667 16:22157591-22157613 TGTCCATTTTAAAAATTGGATGG - Intergenic
1135803191 16:25518236-25518258 TGTCCTATTGACAAAGATCATGG + Intergenic
1138790296 16:59895893-59895915 TGTTTATTTTAAAAAGAGTAGGG + Intergenic
1138970759 16:62140440-62140462 TCTAAATCTTACAAAGAGCAAGG + Intergenic
1140491133 16:75336924-75336946 TGTCCAGTTTTTAAAGGGCAAGG - Intronic
1141113505 16:81289273-81289295 TTTCCATTTTACAGAGGGGAAGG + Intronic
1141753938 16:85978839-85978861 TCTCCATTTTTCCAAGGGCAAGG - Intergenic
1143384001 17:6515502-6515524 TGTACATTTTACAAAAAGGTGGG + Intronic
1143591188 17:7886448-7886470 TGACAGTTTTACAAAGAGCCCGG - Intronic
1143767821 17:9149190-9149212 TGTCCATTTCATAAAGCACAGGG + Intronic
1143795768 17:9335119-9335141 TGGCTATTTTAAAGAGAGCAGGG - Intronic
1145053247 17:19680665-19680687 TGTCCTTTTTAAACAGGGCAGGG - Intronic
1146597046 17:34178469-34178491 TCCTCATTTTACAAAGATCAAGG + Intergenic
1150570285 17:66379954-66379976 AGTCCATTTTAGAAAAATCAAGG - Intronic
1150881110 17:69029427-69029449 TGTTCATTTTGGAAAGATCAGGG - Intronic
1153169823 18:2303141-2303163 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1153417949 18:4870446-4870468 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1154157716 18:11956929-11956951 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1155803631 18:30139911-30139933 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1155934277 18:31739151-31739173 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1156898706 18:42275739-42275761 TGTACATTTTACCAAGGACATGG - Intergenic
1157367965 18:47083932-47083954 TAGCCCTTTTACAAACAGCAAGG - Intronic
1158826178 18:61222807-61222829 TGGCTAATTTATAAAGAGCAGGG + Intergenic
1159097289 18:63918620-63918642 TGTCCAGTGGGCAAAGAGCAAGG + Intronic
1159441975 18:68493149-68493171 TCTCCCTTTAACCAAGAGCAGGG - Intergenic
1160018226 18:75160129-75160151 TGTCCACCTTGCAAACAGCAGGG - Intergenic
1163077995 19:14912958-14912980 TGACTATTTTAAAGAGAGCAGGG + Intergenic
1164633678 19:29777740-29777762 TGTCCATGTGACCCAGAGCACGG + Intergenic
925745746 2:7042235-7042257 TTTCCATTTTACATCAAGCAGGG - Exonic
925885172 2:8389166-8389188 TTTCCATTTTACAGAGACTAAGG - Intergenic
925970634 2:9104400-9104422 TTTACAGTTTACAAAGTGCATGG + Intergenic
926091461 2:10052984-10053006 TGTCCAGTTTACTAAAAGAAGGG - Exonic
928163138 2:28948179-28948201 TATTCACTTTACAAAGAGAATGG - Exonic
928452728 2:31391346-31391368 TGTCCATACTACAAAAAGAATGG - Intronic
929847619 2:45546637-45546659 TGTACATCTTAAAAAGAGAAGGG + Intronic
930027078 2:47035516-47035538 TGTACATGTCACACAGAGCAAGG - Intronic
930174232 2:48285236-48285258 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
931136571 2:59409185-59409207 TGTCCATTCTTGAAGGAGCAAGG + Intergenic
933883447 2:86695324-86695346 TGGCTATTTTAAAGAGAGCAGGG - Intronic
934877968 2:97943619-97943641 TGTCGATTTGCAAAAGAGCAAGG - Intronic
934887561 2:98038194-98038216 TGTCCATTTTATAGACAGGAGGG - Intergenic
936638064 2:114281902-114281924 TGACCATTTCACCAAGTGCAAGG - Intergenic
940561069 2:155297990-155298012 TGCTTATTTTACAAAGACCAAGG - Intergenic
940869207 2:158846121-158846143 TGTGCAGTTGACAAAGGGCAGGG - Intronic
941159475 2:162019842-162019864 TTTCCATTTTGCAAAGAGTAAGG + Intronic
941963007 2:171272218-171272240 TTTACATGTTACAAAGAGCCAGG + Intergenic
942109535 2:172666569-172666591 TGGCTATTTTAAAAAGAGCAGGG + Intergenic
942409825 2:175697342-175697364 TGTCCATCTTAAAAAGTACAGGG - Intergenic
945142083 2:206697716-206697738 TGTCCTATATACAAAGAGCTAGG - Intronic
945483160 2:210365557-210365579 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
946240557 2:218351923-218351945 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
946437547 2:219667719-219667741 TCTCCTTTTAACAGAGAGCAGGG + Intergenic
947651979 2:231794635-231794657 TATACATTTTTCAAATAGCAAGG + Intronic
1171254135 20:23673782-23673804 ACTCCGTTTTACAAAAAGCATGG - Intergenic
1175630566 20:60532188-60532210 TATACATTTTGCAAACAGCAGGG - Intergenic
1176136399 20:63523972-63523994 TGACTATTTTAAAGAGAGCAGGG + Intergenic
1177162984 21:17568870-17568892 TTTCCATTTTAGAAAGTCCATGG - Exonic
1177331835 21:19674520-19674542 TCTCTATTTTATAAAGGGCAAGG - Intergenic
1178158617 21:29884459-29884481 TGTCCATAATACAAAGAGTCGGG - Intronic
1178381516 21:32113671-32113693 TGTCCATTTGATGAAGAGCCAGG + Intergenic
1179281371 21:39937031-39937053 TGTCCATTTTATAGAGGGGAAGG - Intergenic
1180125625 21:45788282-45788304 TGTCCATCTACCAAAAAGCAAGG - Intronic
1182888105 22:33793246-33793268 TGTCAATTTTAAAAATATCATGG + Intronic
1183217027 22:36487370-36487392 TGGCTATTTTAAAGAGAGCAGGG + Exonic
1183557685 22:38543869-38543891 TGGCTATTTTAAAGAGAGCAGGG - Intronic
1184053795 22:42030381-42030403 TATCCAATTTACAGAAAGCAGGG + Intronic
1184673265 22:46026916-46026938 TGTCCCTTTTAAAAACTGCATGG - Intergenic
949446898 3:4144704-4144726 TGTAGATTTTACATAGAGTAGGG - Intronic
949809740 3:7993303-7993325 GCTTCATTTTACAAAGAACAGGG + Intergenic
949904902 3:8851175-8851197 TTTCCAGTTTGAAAAGAGCATGG + Intronic
950333507 3:12175860-12175882 TGGCCATGTCACCAAGAGCAGGG + Intronic
950594050 3:13963227-13963249 TGGCTATTTTAAAGAGAGCAGGG + Intronic
950595120 3:13973043-13973065 TGGCTATTTTAAAGAGAGCAGGG + Intronic
951056347 3:18150391-18150413 TGTCTATGTCACAGAGAGCAGGG + Intronic
951329599 3:21350158-21350180 TTTCCACTTCACAAAGAGGAAGG + Intergenic
951646081 3:24892556-24892578 TGAGCATTTTATAAAGAGAATGG + Intergenic
951775886 3:26309818-26309840 TGGCTATTTTAAAGAGAGCAAGG - Intergenic
951933110 3:27992100-27992122 TGTACATTTAACAAAGGCCAGGG - Intergenic
952215523 3:31274274-31274296 TTACCATTTTAAAAAGAGAAGGG - Intergenic
953035618 3:39208059-39208081 TATCCACTTAACAAAGAGAAAGG - Intergenic
953644161 3:44738531-44738553 TTTCCATTTTACAAATAAAAGGG - Intronic
954190550 3:48957078-48957100 TGTCCATTTTATAAAGTGGTAGG + Intronic
955077031 3:55623684-55623706 TGGCTATTTTAAACAGAGCAGGG - Intronic
955123825 3:56089352-56089374 TGTCCAGTCTTCCAAGAGCAAGG + Intronic
955148051 3:56339592-56339614 TTTCCCTTTTAAAAAGATCAAGG + Intronic
955807121 3:62748386-62748408 TGTGCATTTTAGAAGGAGTAAGG - Intronic
956020975 3:64932979-64933001 TGGCTATTTTAAACAGAGCAGGG - Intergenic
956775038 3:72557941-72557963 TGGCTATTTTAAAGAGAGCAAGG + Intergenic
957268626 3:78001108-78001130 TGTCAATATTAGAAAGATCAAGG - Intergenic
957334857 3:78814863-78814885 GGGCCATTTTCCCAAGAGCATGG + Intronic
957556167 3:81766871-81766893 GGTCCATTTTACAGAGAGCCAGG + Intergenic
958000841 3:87746985-87747007 TGTCCTTTTTACAGAGTTCAAGG + Intergenic
958524006 3:95228698-95228720 TGGCTATTTTAAAGAGAGCAAGG - Intergenic
959890127 3:111545459-111545481 TGTACATTTTAAGAAAAGCAAGG + Intronic
960445440 3:117743354-117743376 GGTCCATTTTACAGAGTGCTGGG + Intergenic
962920185 3:139943540-139943562 TGCCCATTGTCCAAACAGCATGG + Intronic
963666969 3:148200183-148200205 GGTCCAATTTCCAAAAAGCATGG + Intergenic
963669110 3:148229942-148229964 TGTCCTTATTAAAAAGAGGAAGG - Intergenic
964538826 3:157756714-157756736 TCTACATTTTACAAAGTGGAAGG + Intergenic
965274481 3:166663446-166663468 TGGCTATTTTAAACAGAGCAGGG - Intergenic
966454558 3:180100501-180100523 TTTCCATGTTACAAAAACCAAGG - Intergenic
968137868 3:196232035-196232057 TGTCCATTATTCTAGGAGCAGGG + Intronic
969291787 4:6244840-6244862 TGGCCATTTCAAAGAGAGCAGGG + Intergenic
969397207 4:6929968-6929990 TGTCTTTTTTAGAAACAGCATGG - Intronic
970319842 4:14864215-14864237 ACTCCATTTTACAGAAAGCAAGG + Intergenic
972226536 4:37019345-37019367 TGTACATTTTATAAAGTGCTTGG - Intergenic
974149807 4:57992136-57992158 TGTCCACTTGAAAAGGAGCATGG + Intergenic
975469269 4:74746610-74746632 TGTCCATTTTCAAATGAGCAAGG + Exonic
975477335 4:74838809-74838831 TGTACAGTTTACAAAGAAAAAGG - Intergenic
976933336 4:90597145-90597167 TTTCAATTTTACAAAGTCCATGG - Intronic
978071039 4:104470048-104470070 TCATCATTTTCCAAAGAGCAAGG + Exonic
978877172 4:113655590-113655612 TGTAGACTTTAGAAAGAGCAAGG - Intronic
981090775 4:140730003-140730025 TCTCCATTTTAGCAAGAGCCAGG + Intronic
981142370 4:141283247-141283269 TCTCCACTTTACATAAAGCATGG - Intergenic
981570087 4:146142503-146142525 TGTCCCTTTAACAAAGACCATGG - Intergenic
981847560 4:149186916-149186938 TGTCCATTTTAAAAACTGTATGG - Intergenic
982267044 4:153547600-153547622 TTTCCATTTTACAGAGAATAAGG + Intronic
982299928 4:153868009-153868031 TGTGGATTTTACAAGGATCATGG - Intergenic
983637972 4:169917477-169917499 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
983674027 4:170270974-170270996 TGGCTATTTTAAAGAGAGCATGG - Intergenic
984579739 4:181498317-181498339 TGACCATATTACCAAAAGCATGG + Intergenic
984617325 4:181913545-181913567 TGGCTATTTTAAAGAGAGCAAGG + Intergenic
986095001 5:4545863-4545885 GGTGCATTTGACAAAGAGAAGGG + Intergenic
986678400 5:10210871-10210893 TCTCTATTTTAAAAAGAGAAAGG + Intergenic
988499460 5:31772321-31772343 TGGCTATTTTAAAGAGAGCAAGG - Intronic
989065319 5:37455000-37455022 TGTATATTTTATAAAGTGCATGG + Intronic
989305679 5:39952591-39952613 TGTCAATATTAGAAAGATCATGG + Intergenic
989381565 5:40814016-40814038 CGTCCATTTGACAAAGAGCTGGG + Intergenic
990044074 5:51407296-51407318 TGTGCATTTTAGAAATCGCATGG - Intergenic
990329078 5:54707674-54707696 TGTCAATTTTACAATTAGCAGGG - Intergenic
990570075 5:57069482-57069504 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
990603134 5:57381434-57381456 TGTCCATCTTTCAGAGAGAAGGG - Intergenic
990748653 5:58987125-58987147 TGTCCTTTCTAAGAAGAGCAGGG - Intronic
991459851 5:66846481-66846503 TGTCCATTATACTAAGAGGCAGG + Intronic
993731016 5:91423155-91423177 TATCCATTTTACAAACAGGAAGG + Intergenic
994251390 5:97541480-97541502 GGTCCATTTTACAGAGAGCCCGG + Intergenic
994554082 5:101275215-101275237 TGTCAATTTTACCAAGGGGAAGG - Intergenic
995037584 5:107552705-107552727 TCTCCATTTTACAAAGCCAAGGG + Intronic
996493270 5:124124363-124124385 TGTCCCTTTTACACACAGAAAGG - Intergenic
996811564 5:127521381-127521403 TGGCTATTTTAAAGAGAGCAGGG - Intronic
997260231 5:132460047-132460069 TGTGCTTTTTGAAAAGAGCAGGG + Intronic
997908773 5:137847803-137847825 TGTTCTCTTTACAAAGAGCTAGG + Intergenic
999048471 5:148495567-148495589 TGTCCATTGGACAAATACCAAGG - Intronic
999770228 5:154770091-154770113 TGTCCATTTTCCACAGAACTGGG - Intronic
1000372113 5:160547147-160547169 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1001194543 5:169660068-169660090 TGTCCATTGTAGAAATAGCCAGG + Intronic
1002936795 6:1680832-1680854 TGTCCATTTCAGAAATGGCAAGG - Intronic
1003255501 6:4471548-4471570 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1003257580 6:4487843-4487865 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1003788591 6:9516336-9516358 TGTCCAGTTTACACAGCCCAGGG - Intergenic
1004431061 6:15543824-15543846 TGTCTCTTTTAAAGAGAGCAAGG - Intronic
1004495553 6:16159704-16159726 TGTCCCTATTCCAAAGAGGAAGG - Intergenic
1004622421 6:17342738-17342760 TGTCCATCTAAGAAAGAGAAAGG - Intergenic
1004647563 6:17577412-17577434 TGGCTATTTTAAAGAGAGCAAGG + Intergenic
1004894039 6:20129365-20129387 TGTACATTTCACAGAAAGCATGG - Intronic
1004971835 6:20919172-20919194 TATCCATTTTGAAAAGAGGAAGG + Intronic
1005042148 6:21609503-21609525 GGTCCATTTTACAGAGAGCCCGG + Intergenic
1005668331 6:28080152-28080174 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1005817199 6:29563350-29563372 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1007819010 6:44546455-44546477 TTTCCATTTTGCAAATGGCAGGG - Intergenic
1008062630 6:47014553-47014575 TGGCCAGTATGCAAAGAGCAAGG - Intronic
1009188151 6:60598586-60598608 TGTGCAATTTAGAAAAAGCAGGG + Intergenic
1011424666 6:87213505-87213527 TGGCTATTTTAAAAAGAGCAGGG + Intronic
1012659942 6:101875160-101875182 TGTCCAGTTTACACAAGGCAGGG - Intronic
1013270781 6:108543801-108543823 TGGCCATTTTGCAAAGATCCAGG + Intergenic
1013441634 6:110177632-110177654 TGTCCATTTTGTAAATTGCAAGG + Intronic
1014886496 6:126787762-126787784 TGTGCAGTTTACAAAGTGTATGG - Intergenic
1015322364 6:131890375-131890397 TGTTAATGTTACACAGAGCACGG + Exonic
1015748568 6:136537248-136537270 TGTCCATTTTAGACACAGCTGGG + Intronic
1016449818 6:144170602-144170624 ATTATATTTTACAAAGAGCATGG + Intronic
1019059466 6:169245247-169245269 TCTTCATTTTACAAAGATGAAGG - Intronic
1019966143 7:4500238-4500260 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1020745654 7:12075183-12075205 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1020789276 7:12605414-12605436 TATCCCTTTTCCAAAGTGCATGG + Intronic
1020924110 7:14302554-14302576 TGTCCTTTTGAACAAGAGCAAGG - Intronic
1022203643 7:28142139-28142161 TGTCCTGTTTACAAAGAAGAGGG - Intronic
1024367481 7:48537604-48537626 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1024549193 7:50546664-50546686 TGTTCATTTAACAGAGAACATGG - Intronic
1026437615 7:70413499-70413521 TTTCCATTTGACAAAGAACCTGG + Intronic
1026543648 7:71302714-71302736 AGTCCATTTTTTAAAGAGCACGG - Intronic
1026699060 7:72623440-72623462 TTTCCTTTTTACCAAGCGCACGG + Intronic
1027336581 7:77157258-77157280 TGCTCATTTTAGAAACAGCAGGG - Intronic
1027894073 7:84018095-84018117 TGTCGATTTGACGAAGAGCAGGG - Intronic
1029779211 7:102713851-102713873 TGCTCATTTTAGAAACAGCAGGG + Intergenic
1030909693 7:115231401-115231423 TGTCCACTTAACAAAGAGAAAGG - Intergenic
1031283222 7:119832498-119832520 TCTACATTTTACAAAGAATAAGG + Intergenic
1031945712 7:127838046-127838068 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1032464940 7:132138270-132138292 TCTCCATTTGACCAACAGCAGGG + Intronic
1032744230 7:134770105-134770127 TTTTCTTTTTACAAAGAGAAAGG - Intronic
1034421035 7:150990892-150990914 TGGCTATTTTAAAGAGAGCAGGG + Intergenic
1035421224 7:158730241-158730263 TGTCCATGTGACACAGAGGACGG + Intergenic
1036104173 8:5822621-5822643 TGGCTATTTTAAAGAGAGCAAGG + Intergenic
1038892294 8:31739162-31739184 TGTCCATCCTTCAAAGAGAAAGG - Intronic
1039014912 8:33136562-33136584 TGCTCATTTTACAAAGAACCAGG - Intergenic
1039191313 8:34979003-34979025 TGCCCATGTTACAAATGGCAAGG - Intergenic
1039573362 8:38604217-38604239 TGCCTATTTTTCACAGAGCAGGG + Intergenic
1040748953 8:50682286-50682308 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1041146845 8:54885079-54885101 TATCAGTTTTACAAAGAACATGG - Intergenic
1042415311 8:68511384-68511406 TGGCTATTTTAAAGAGAGCAGGG + Intronic
1042676199 8:71324997-71325019 TTTCCATTTAAGAAAGAACATGG - Intronic
1045653214 8:104362057-104362079 TTTCTAATTTACAAAGAGTATGG + Intronic
1046974906 8:120263538-120263560 TTTACATGTTCCAAAGAGCAAGG + Intronic
1048840138 8:138558399-138558421 TGTGCATTTGACAAAGAGCAAGG - Intergenic
1050158591 9:2694023-2694045 TGTCCATCTTTCAAAGACCCAGG + Intergenic
1050498342 9:6267745-6267767 TGTCCAATGTATTAAGAGCAGGG + Intergenic
1053319353 9:37081269-37081291 TGTCCATTTTTCAAATGCCACGG - Intergenic
1053341477 9:37338188-37338210 TGTCCTGTTTACAAAAAGAAAGG + Intronic
1053448347 9:38171002-38171024 TGGCTATTTTAAAGAGAGCAAGG + Intergenic
1055049910 9:71968872-71968894 TGGCTATTTTAAACAGAGCAGGG + Intronic
1055966679 9:81872445-81872467 TGGGCATTTTCCAAAGGGCAGGG + Intergenic
1056831363 9:89919718-89919740 AGTCAATTTTACAAAGATCTTGG - Intergenic
1058699925 9:107591465-107591487 TGCCCATTTCACAGAGAGGAAGG + Intergenic
1060850962 9:126875133-126875155 TGTGTATTTTACACACAGCATGG - Intronic
1185522710 X:753771-753793 TCACCATTTTGCAAAGTGCAGGG + Intergenic
1185767328 X:2736292-2736314 GGGCCGTTTTACAAATAGCACGG + Intronic
1186076181 X:5881863-5881885 AGTCCAGTTTAAAAACAGCAAGG - Intronic
1187129733 X:16490812-16490834 AGTACATTTTTCAAAGACCATGG + Intergenic
1191625626 X:63267498-63267520 TGTCAATTTTCAAAAAAGCAAGG - Intergenic
1193437351 X:81492202-81492224 TGTCCATTTTACAGATAGTGCGG + Intergenic
1195127727 X:101824491-101824513 TTCCCATTTTACAGAGATCAAGG - Intergenic
1195484655 X:105390163-105390185 TTTACATTTTAGAAAGAGCATGG - Intronic
1195715613 X:107815691-107815713 TGTTCTCTTTACATAGAGCAGGG - Intergenic
1197781810 X:130167354-130167376 TTTTCATTTAACAAACAGCATGG - Intergenic
1197934345 X:131725310-131725332 TGGCTATTTTAAAGAGAGCAGGG - Intergenic
1198117073 X:133554696-133554718 TGGCTATTTTAAAGAGAGCAGGG - Intronic
1198624137 X:138549961-138549983 TTTCCTTTTTATAAAGAGCAAGG + Intergenic
1198741082 X:139843555-139843577 TGGCCTTTTTTCATAGAGCATGG + Intronic
1199384009 X:147202858-147202880 TGTCCATATTAGACAGATCAAGG + Intergenic
1199574632 X:149301622-149301644 TGTGCTTTTTCCAAAGAGAATGG - Intergenic
1200147246 X:153932647-153932669 TGTCCACTCTACAAATGGCAGGG - Intronic
1201296665 Y:12469254-12469276 TGGTTATTTTAAAAAGAGCAGGG + Intergenic
1201751563 Y:17437065-17437087 TGTTCATTTTAAAAAAAGCCTGG + Intergenic
1201865243 Y:18645495-18645517 TGCTCATTTTACAAAGATAATGG + Intergenic
1201903728 Y:19068524-19068546 TGGCTATTTTAAAGAGAGCAGGG + Intergenic